2 years ago

Which statement describes an introduced species?

Biology

2 answers:

777dan777 [17]2 years ago

8 0

It should be C. It is very literal, but I think C

lana66690 [7]2 years ago

8 0

The correct answer for this question is C) It has been moved to a new area.

An introduced species is not native and It has been introduced to that place. It may be introduced to that place accidentally or deliberately. Some times new species are introduced in a locality to control the overgrowth of other species while some introduced species have negative impact on the ecosystem like gypsy moth in eastern North America.

You might be interested in

In terms of environmental economics, the only factions that disagree with one another are environmentalists and economists.

Anika [276]

I think the answer is<span> TRUE</span>

7 0

2 years ago

Read 2 more answers

what is one possible combination that can be found in the gamete formed by an individual with the genotype AaBB?

Luden [163]

Answer:

(Ba) and (BA)

Explanation: those could be one of the combinations if u put them on a punnet square

8 0

2 years ago

Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.

grin007 [14]

Answer:

4 1/4

Explanation:

17/4 = 4/4 + 4/4 + 4/4 + 4/4 + 1/4

4 + 4 = 8

8+8=16 = 16/4

16/4 + the 1/4 remaining in the equation = 17/4

so 4/4 + 4/4 + 4/4 + 4/4 = 4

4 + 1/4 = 4 1/4

sorry if you couldnt follow along. I am not good at explaining things but the answer is 4 1/4

(I also took the test)

3 0

3 years ago

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

2 years ago

If a plant cell lost its plastids, what would go wrong with it

ivann1987 [24]

<span>A plant's plastids contain its chlorophyll, which enables it to photosynthesize. If it lost the plastids, it would not be able to photosynthesize, which is the only way it can get food, so it would die.</span>

4 0

2 years ago