1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
2 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]2 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
What does a nucleus do
loris [4]
The nucleus directs all activities that happen within the cell and contains the cell genetic material (DNA).<span> The nucleus gives the signal to the cell to grow, divide and/or make proteins. </span>
8 0
3 years ago
How might environmental manipulation of a crop have unexpected consequences?
Elden [556K]
All of the above options are correct because all the given three options are possible
3 0
3 years ago
Read 2 more answers
1. which of the following list objects in space in order of increasing size.
ladessa [460]
Im pretty sure itwould be b
6 0
3 years ago
Read 2 more answers
The male sexual response includes erection and orgasm accompanied by ________.
netineya [11]
The most appropriate answer is A !!
3 0
3 years ago
Which part of the brain is responsible for speech?
alexandr1967 [171]

Answer:

<u>C. Broca's Area</u>

Explanation:

Broca’s area is located in the front part of the left hemisphere of your brain. It has an important role in turning your ideas and thoughts into actual spoken words. Broca’s area is the most active Source right before you speak.

Broca’s area also helps to pass the information to another part of your brain called the motor cortex, which controls the movements of your mouth. It’s named after a French doctor, Pierre Paul Broca, who discovered the region of the brain in 1861.

<u>Hope this helps!</u>

5 0
2 years ago
Read 2 more answers
Other questions:
  • Cellular differentiation is responsible for _____?
    6·2 answers
  • When a wind-up toy is released, the energy in the compressed spring is converted into the _____ energy of the toy's moving parts
    7·2 answers
  • Which of the following statements is true for a eukaryotic cell?
    6·1 answer
  • How do trade winds and westerlies affect hurricanes?
    13·2 answers
  • What is the difference between food chains and food webs?
    10·2 answers
  • Which organelle forms the surface of a cell, separating its contents from the outside world PLEASE HELP
    14·1 answer
  • According to the graph, which renewable energy resource did the United States use MOST during 2007?
    12·2 answers
  • How can I distinguish between the three stages of Interphase (G1, S, and G2)?
    14·1 answer
  • When observations, over time, repeatedly support an assumption, the assumption comes to be known as a principle true or false
    6·1 answer
  • Mars has ice caps containing frozen CO2 and H2O, and little to no atmosphere. It’s lack of atmosphere causes it to very hot in t
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!