1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]3 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
Which component of ATP is also found in DNA and RNA
liberstina [14]
Adenine is a component of ATP and is also found in both DNA and RNA.
6 0
3 years ago
Read 2 more answers
A nurse and a nursing student are discussing the plan of care for a patient with schizophrenia. The patient, who has been taking
eduard

Answer:

Because this may be an exacerbation of psychosis, the provider may increase the dose of the FGA.

Explanation:

Schizophrenia may be defined as the medical condition in which the individual is not able to understand the reality and  interpret the reality in the different ways.

FGA (First-generation antipsychotics) is the treatment used for the patients suffering from schizophrenia. This medication is quite reasonable and cheap. Even after the failure of FGA, the patient needs to go for the different treatment. The further increase of FGA doses might affect the individual health.

Thus, the correct answer is option (B).

5 0
3 years ago
In which kingdoms are all organisms multicellular?
Pepsi [2]
Multicellular organisms are referred to as eukaryotes while the opposite, unicellular organisms, are called prokaryotes. Among all the kingdoms, I believe the kingdom which all organisms are multicellular are Animalia and Plantae.
5 0
3 years ago
4)
zaharov [31]
C. Lactic acid fermentation
6 0
3 years ago
Read 2 more answers
Which of these is most likely to produce radioactive wastes?
Vlad1618 [11]
A. a nuclear power plant
7 0
3 years ago
Read 2 more answers
Other questions:
  • You need to measure three things: 1. a quantity of water 2. the length of a leaf 3. the mass of a small stone Which unit of metr
    7·1 answer
  • Whether the organism is a pea plant or a human being, the information in the DNA of the cell's nucleus directs synthesis of prot
    8·1 answer
  • What two variables can affect the force of gravity on an object?
    9·1 answer
  • Imagine that two protein kinases, PK1 and PK2, act sequentially in an intracellular signaling pathway. When either kinase is com
    15·1 answer
  • Which atmosphere gas most directly influences the rate of photosynthesis
    15·1 answer
  • What was produced as a result of the human genome project
    7·1 answer
  • Which organelle belongs in the center of the diagram that is comparing the plant cell and animal cell?
    7·1 answer
  • Zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
    10·1 answer
  • Finches with harder, more<br> rounded beaks probably use it to _____
    10·1 answer
  • Which approach is most directly concerned with assessing the relative impact of both nature and nurture on our psychological tra
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!