1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]3 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
Which atoms could join together to form a molecule of an element
Reika [66]

Answer:

Maybe this helps! Atoms come together to form molecules because of their electrons. Electrons can join (or bond) atoms together in two main ways. When two atoms share electrons between them, they are locked together (bonded) by that sharing. These are called covalent bonds.

5 0
3 years ago
Como os fósseis auxiliam nos estudos cientificos?
sergey [27]
Fósseis ajudam cientista a entender a evolução na Terra
5 0
3 years ago
Read 2 more answers
If an organic nerve toxin (acting at the neuromuscular junction) renders the ion channel of postsynaptic acetylcholine receptors
ddd [48]

The answer is convulsions. This occurs when there are continuous involuntary contraction and relaxation of muscle of the body as a result of a continuous unchecked transmission of impulse by neurons to the muscles. This can only occur if the ion channels of the neurons are continually kept open, such as by the toxin in this case.

8 0
3 years ago
Photosynthesis can be modeled by its overall chemical reaction. Classify the substances as reactants or products of the overall
maksim [4K]

Answer:reactants: carbon dioxide water

Products:oxygen sugars

Neither reactants nor products: nitrogen ammonia

Explanation:

3 0
3 years ago
12. A bacterial infection that affects the nervous system is _____.
Mrrafil [7]

Answer:

12. Brain abscesses

13. Cytotoxic agents

Explanation:

I didn't really understand 14 and 15,

if you need an example of cytotoxic agent one of them is Hydrochloric acid which is one of the most common acids

Hope it helps.

4 0
3 years ago
Other questions:
  • One parent has curly hair the other has straight hair their child has wavey hair this is an example of what?
    11·1 answer
  • This aquifer supplies one-third of the irrigation water in the United States
    14·1 answer
  • A patient develops postthrombotic syndrome. the nurse assesses lipodermatosclerosis, which has what hallmark characteristic?
    9·1 answer
  • A 2-month-old infant experiencing severe diarrhea is prescribed intravenous fluid replacement. before adding potassium to this s
    14·1 answer
  • Which is the broadest most inclusive category of life on Earth
    14·1 answer
  • Linnaeus lived hundreds of years before scientists discovered DNA, genes, and the roles of DNA and genes in determining the trai
    5·1 answer
  • Need help with this ! Thank you
    9·2 answers
  • A transcriptional repressor that controls the transcription of gene A is not normally active unless bound by an effector molecul
    9·1 answer
  • Forms when a river deposits sediments at the bottom of the mountain.
    8·2 answers
  • Most of the energy we get from the sun comes to us as
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!