1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]3 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
Earth has roughly _________ times more atmospheric pressure than mars
zalisa [80]
Earth has roughly surface times more atmospheric pressure than mars.
Sorry if it's wrong i tried!
7 0
3 years ago
A nutritionist notices that a patient’s diet is lacking in sugars. Which organic group is she referring to? a. lipids b. protein
Akimi4 [234]
The answer is D. The sugar belongs to carbohydrates. The lipids is consisted of glycerol and fatty acid. The proteins is consisted of amino acids. The nucleic acids is consisted of nucleotide.
7 0
3 years ago
Read 2 more answers
How does using killed or weakened bacteria in an immunization help the body prevent infections
snow_lady [41]
<span>Basically, the body needs to know what it is defending against. Your body can still (usually) fight off infection, even without an immunization, but it takes longer. Basically, your body creates cells with a receptor for a specific disease. When this cell finds the disease it is programmed for, it will send out signals to the "killer" cells to come and kill it. If your body doesn't have the "seeker" cells, it can't fight off the infection until it does. The opposite end are autoimmune diseases, where your immune system starts attacking itself.

brainlest answer</span>
3 0
3 years ago
Read 2 more answers
Describe how the SARS-CoV-2 virus affects your cells.
gogolik [260]

Answer:

SARS- CoV- 2 is a virus that infects human by the oral-respiratory way in which the virus enters the body and these viruses have spikes on their surface made of spike proteins that allow these viruses to bind with the infected cell.

The infected cells have ACE2 receptor that is protein present on the surface of the human cells. Binding allows the structural change in the virus to fuse and enter in the cell where viruses reproduce them selves with the cell with cell system.

5 0
3 years ago
Read 2 more answers
The diagram shows a certain type of fungus growing on food.
NeX [460]

Answer:not c

Explanation:

C is not the correct answer took the test

3 0
3 years ago
Read 2 more answers
Other questions:
  • individuals with hiv sometimes contract secondary infections that ate rare in the rest of the population this is because people
    15·1 answer
  • Compared to benign tumors, malignant tumors are different because the cells in malignant tumors ________.
    7·1 answer
  • Is coronary circulation the same as pulmonary circulation?
    13·1 answer
  • Why does the phylogenetic tree tell you about the evolutionary relationships of animals?
    12·2 answers
  • What is missing in the following nuclear equation?<br> 99 TC → ? + 99 Ru<br> 43<br> 44
    15·1 answer
  • How were redi’s and pasteur’s experiments similar
    14·1 answer
  • Whoever answers first get real brainiest
    6·1 answer
  • Among us code:<br> SRCSMF
    11·2 answers
  • The Fresh Kills Landfill in Staten Island, New York, is in the process of becoming the Fresh Kills Park. Gas left over from the
    11·1 answer
  • The cytoplasm and two nuclei that are formed during mitosis are separated into two identical daughter cells during _______. A. P
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!