1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
2 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]2 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
Trees planted on hills keep lakes + streams from becoming muddy how?
kolbaska11 [484]
The roots of the trees keeps the soil in place

8 0
3 years ago
When transcription occurs in eukaryotic cells, a DNA strand is copied to an mRNA strand that contains introns and exons. Which o
Tomtit [17]

Introns because they are coding sequences.
Exons because they are non-coding sequences.
8 0
3 years ago
in chickens, black feathers are dominant to white feathers. create a punnett square for a cross between two chickens that have b
faust18 [17]

the offspring has a 50% chance of having black feathers and a 50% chance of white feathers

6 0
3 years ago
What would most likely cause the cycle to continue? An explanation inspires new questions and the process of making new observat
Gnoma [55]

Answer:

An explanation inspires new questions and the process of making new observations.

Explanation:

6 0
3 years ago
Read 2 more answers
How does an emerging idea differ from scientific consensus?
MA_775_DIABLO [31]
<span>The way that an emerging idea differs from that of a scientific consensus is that an emerging idea has not been tested repeatedly. What best describes an idea that has scientific consensus is that most , but not necessarily all, scientists agree with an idea.

Answer: A) An emerging idea has not been tested repeatedly.

I hope it helps, Regards.</span>
8 0
3 years ago
Other questions:
  • Elements in the first group of the periodic table are
    14·2 answers
  • A speeding driver sustained a closed-head injury in an acceleration/deceleration accident from striking a tree front end first.
    12·1 answer
  • Please help me fast , Thank you (:
    15·1 answer
  • This is the general term for the various chemical products used in agriculture. It may refer to pesticides, fertilizers, manures
    15·1 answer
  • A great deal of the Blue Ridge was eroded. The eroded rock eventually finally settled in Virginia’s coastal plain. What process
    14·1 answer
  • Name an element found in proteins but not in carbohydrate or lipids
    14·1 answer
  • Explain how manure and human hair can cause ill health to human beings
    8·1 answer
  • Waxing describes the period where we see more and more of the moon from Earth. true or false
    5·2 answers
  • Autosomal recessive traits require one copy of an allele to be expressed. true or false
    7·1 answer
  • PLS HELP I BEG
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!