1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
2 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]2 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
The wall of the alveolus is composed of which type of epithelium
Dmitrij [34]
Simple squamous epithelium
5 0
3 years ago
What happens if the correct ligand binds to ligand-gated sodium channel in a post-synaptic neuron?
Maru [420]

Answer:

Post-synaptic neurons after receiving correct ligands called as neurotransmitter in correct amount generates action potential. This action potential may be inhibitory or accelatory.

Explanation:

Postsynaptic neuron :

These are the neurons that is present after the gap called synapse. These neurons after receiving correct ligands called as neurotransmitter in correct amount generates action potential. This action potential may be inhibitory or accelatory.

There are number of neurotransmitter. These includes

GABA ergic: This neurotransmitter is often inhibitory.

glutamatergic: This neurotransmitter is often excitatory.

Adrenergic: This neurotransmitter releases norepinephrine.

Cholinergic: This neurotransmitter activates vertebrate neuromuscular junction.

6 0
3 years ago
A moss-covered log is overturned by a hungry bear looking for insects to eat. The bear disturbs an ant colony, and some chipmunk
ValentinkaMS [17]

Answer:

C) They are part of a community

Explanation:

A community represents the sum total of populations of different species present together in an area or ecosystem. In a community, the organisms of these different species may benefit or harm each other and exhibit little or more interdependence. In the given example, beer, insects, ants, chipmunks represent the organisms of different species that are present together in a habitat. They interact with each other in various ways. For instance, the bear is a predator of insects.

5 0
3 years ago
Explain how seasonal fires benefit grassland ecosystems.
Soloha48 [4]

Answer:

Without fires, there would be no life on Earth . Fires are key to maintaining the proper oxygen concentration in the atmosphere; fire regulates the carbon cycle and life, as we know it, is based precisely on carbon

Explanation:

Although we tend to think of fires as a human invention that kills plants, animals, people, fire, as with rain or wind, is an essential natural component, basic to maintain the planet's biodiversity.

As for example, grassland ecosystems are also benefited by the same fires that allow renewal, and generate natural sustainability on the earth through the carbon cycle.

3 0
3 years ago
I need help in biology questions please G10?
Svetlanka [38]

Answer:

ok where is it

we can help only if there is something attached

7 0
3 years ago
Read 2 more answers
Other questions:
  • Multiply: (3x – 5)(–x + 4) Applying the distributive property, the expression becomes (3x)(–x) + (3x)(4) + (–5)(–x) + (–5)(4). W
    12·2 answers
  • DNA and rna are both?
    5·1 answer
  • A population of deer is separated by an emerging volcano. The two populations come back into contact 200 years later, but are in
    12·2 answers
  • What is the missing part of the chemical equation shown below?
    14·1 answer
  • Why is ATP an example of chemical potential energy?
    6·2 answers
  • Which of the following cycles does not involve living organisms?
    7·2 answers
  • Humans usually live in houses or other buildings that protect them from environmental hazards, such as rain, snow, and extremely
    8·2 answers
  • A theory by which prokaryotes gave rise to the first eukaryotic cells. Chloroplasts in plants and mitochondrion in other eukaryo
    12·1 answer
  • Choose one nonrenewable energy source and one renewable energy source. Describe how the use of each source affects the environme
    7·2 answers
  • Identify three processes that fix atmospheric nitrogen
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!