1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
2 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]2 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
In which form do plants store energy?<br> starch<br> glycogen<br> chitin<br> cellulose
Viefleur [7K]

Answer:

starch

Explanation:

plant store energy in the form of starch and animal store energy in the form of  glycogen these starch and glycogen are converted into glucose whenever body needs energy

8 0
3 years ago
Read 2 more answers
Which problem does the Montreal Protocol attempt to remedy?
madreJ [45]

Answer:

A.The hole in the ozone layer

Explanation:

• Montreal protocol is an international treaty that was signed to control the use of substances that are resulting in the depletion of the ozone hole.

This treaty was signed in the year 1987 and became effective form 1989.

• Since the time that this treaty has come into force, there has been a significant improvement in the ozone hole that was observed over Antarctic as it's size has decreased.

• This improvement has been possible because the treaty helped to phase out chemicals such as chlorofluorocarbons, carbon tetrachloride, etc. that are responsible for ozone hole depletion.

5 0
2 years ago
Can you help me ifts science and I’ll give you a branlist list please help me
MissTica

Answer:

The answer is A!

Explanation:

Because liquids and gases move, soilds will stay in place unless you move it.

8 0
3 years ago
Someone help me pleaseee with the answers to both of em
Natasha_Volkova [10]
The answer is “The Nervous System”
6 0
3 years ago
Explain how the digestive tract of different invertebrates affects the size of the organisms they eat.
AlexFokin [52]

My answer will be because these characteristics intervene in the capture and assimilation of the food, having 4 general food behaviors: (1) detritivores, consume a lot of material from the bottom of the water source, (2) herbivores, who consume mostly plant components (filamentous algae and higher plants); (3) periphyton consumers, who are characterized by feeding on microalgae and microinvertebrates and (4) omnivores, in which they indistinctly feed on plant material as an animal of different origin.

8 0
3 years ago
Other questions:
  • What does it mean if something has a visible nuclei
    12·1 answer
  • Neck injuries can sever the nerves that control contraction of the diaphragm. How would this affect breathing?
    6·2 answers
  • What kind of fertilization do reptiles utilize? a. internal. b. external. c. partly internal and partly external. d. none of the
    15·1 answer
  • What is identical for every cell in the 4 organs?
    14·1 answer
  • In the oceans the colder water sinks into deep basins, while warmer water stays closer to the surface. The water then moves arou
    5·2 answers
  • A beaker of distilled water was placed on a bench. Using a pipette a drop of red blood cells was placed at the bottom of the bea
    13·1 answer
  • The transport of specific particles through a membrane by channel proteins is known as facilitated diffusion.
    11·1 answer
  • Which process is a form of autotrophic nutrition?
    14·1 answer
  • A common inhabitant of human intestines is the bacterium escherichia coli. a cell of this bacterium in a nutrient-broth medium d
    10·1 answer
  • Genetic goitrous cretinism and alkaptonuria are metabolic disorders in the ____ pathway.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!