1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
2 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]2 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
NE is a water-soluble molecule that acts as a hormone or neurotransmitter depending on what cell it is released from. The bindin
OverLord2011 [107]

Answer:

.

Explanation:

7 0
3 years ago
What microscope did Anton van Leeuwenhoek use to observe single celled organisms
ikadub [295]
He used a simple microscope
6 0
3 years ago
The mitotic phase of the cell cycle is the combination of mitosis and what other process?
professor190 [17]

Answer:

the cell cycle

Explanation:

Image of the cell cycle. Interphase is composed of G1 phase (cell growth), followed by S phase (DNA synthesis), followed by G2 phase (cell growth). At the end of interphase comes the mitotic phase, which is made up of mitosis and cytokinesis and leads to the formation of two daughter cells.

5 0
2 years ago
Read 2 more answers
Select all the advantages of a multienzyme complex over a metabolic pathway
Kazeer [188]

Answer:

Option A, B, C

Explanation:

The major advantages of multienzyme complex over a metabolic pathway is that it do not require individual pathway for each enzyme activation or inhibition. Instead it responds efficiently to the equilibrium changes of substrate supply and demand as compared to that of enzymes.

It tightly regulates the processes and is also faster than that of the metabolic pathway.

Hence, option A, B and C are correct

8 0
3 years ago
Which best describes how our understanding of DNA and inherited traits has changed over time
MAVERICK [17]
<h3><u>Answer;</u></h3>

It was developed by many scientists over many decades.

<h3><u> Explanation;</u></h3>
  • DNA is a type of nucleic acid that contains two long, twisted strands, known as double helix, that contain complementary genetic information.
  • A gene is a segment of DNA that is passed down from parents to children and confers a trait to the offspring.
  • The traits an organism displays are ultimately determined by the genes it inherited from its parents, known as genotype.
  • Our understanding of DNA and inherited traits has changed over time since it has been continuously developed by many scientists over may decades.
4 0
2 years ago
Other questions:
  • Which type of cell division only occurs in organisms whose cells contain chromosomes?
    15·1 answer
  • Explain how the reduction and rearrangement are accomplished in meiosis
    7·1 answer
  • A cartilaginous structure between the "throat" and the trachea.
    11·1 answer
  • Please answer fast
    8·1 answer
  • Plant cells use specific organelles for photosynthesis in order to produce glucose. Plant cells contain another organelle that f
    10·2 answers
  • The client with chronic kidney disease and congestive heart failure is weak and dyspneic. Lab work reveals a hemaglobin of 6.5 g
    12·1 answer
  • Which characteristic do ferns have that mosses do not?
    7·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism's body cells?
    11·1 answer
  • I need with this question please
    9·1 answer
  • 13. Some flowers are not brightly colored at all, but have a very pungent odor that smells like rotting meat. How do you think t
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!