1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]3 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
How are photosynthesis and cellular respiration related?
Margarita [4]

I'd go with the third one because the products of both of them are oxygen and carbon dioxide.

8 0
3 years ago
Read 2 more answers
Which organisms would be the prey for the hawk?
anzhelika [568]

Other hawks, eagles, owls can prey on them. The Goshawk is well known for removing any competitors from it's territory, even larger species. Large owls sometimes take hawks that are roosting at night or even when they are incubating eggs. Any type of cat, or dog, or marten, indeed any carnivorous mammal.

4 0
3 years ago
Read 2 more answers
Tell the difference between qualitative and quantitative data? Give two examples for each.
Yanka [14]

Answer:

Qualitative data is based on the quality of something an example can be the quality of a camera.

Quantitative data is based on quantity (numbers) an example can be the number of students at a football game

HOPE IT HELPED!! Please give it the best answer.

Explanation:

3 0
3 years ago
What are some pros of being a seismologist rather than being a volcanologist?
slega [8]
What are the answers given?
3 0
4 years ago
It is important to view cells under a microscope because cells can change true or false
mixer [17]

Answer:

it is important to view cells under a microscope because cells can change?

False

Explanation:

Cell does not change when viewing under microscope, it is expedient to view under microscope because it is a microorganism that can not be seen with naked rather than with a microscope

5 0
3 years ago
Other questions:
  • The subunits (building blocks) of proteins are
    7·1 answer
  • When a plant starts to reproduce, auxins are released . Also a large amount of sugar is used to creat energy to build reproducti
    10·2 answers
  • Peptic ulcers are sores in the lining of the stomach that are caused by a bacterial infection. These bacteria increase the acid
    7·2 answers
  • __________ means contrary to the dictates of the conscience; unscrupulous or unprincipled; exceeding that which is reasonable or
    8·1 answer
  • How are flowers similar?
    15·1 answer
  • Explain why earthquake and volcanoes appear in generalized belts around the planet the planet
    15·1 answer
  • Describe how food is digested in a digestive cavity
    8·1 answer
  • How is photosynthesis and cellular respiration cyclical ​
    8·1 answer
  • Help plz
    5·2 answers
  • When the Australian wildfires occurred, what short-term effect did the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!