1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
14

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

other strand be? Start with the top of the strand and work down.
Biology
1 answer:
Ugo [173]3 years ago
5 0

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

You might be interested in
E. coli bacteria was spread on both agar plates and incubated for 24 hours. if you wanted to grow up a large quantity of strepto
ollegr [7]

If you want to grow up a large quantity of streptomycin-resistant E. coli, you would require to pick a colony of the bacteria from the streptomycin-positive plate and allow to grow it on a streptomycin positive plate.

<h3>What is E. coli?</h3>

E. coli may be defined as a type of bacterium that is commonly present in the intestinal regions of humans and other animals, some strains of this bacterium can significantly cause severe food poisoning.

The strain of streptomycin-positive is those population of E. Coli which is significantly streptomycin resistant, while the negative strain has the opposite effect.

That's why if you want to grow up a large quantity of streptomycin-resistant, you must remarkably require to pick only a positive strain of streptomycin for E.Coli bacterium.

Therefore, if you want to grow up a large quantity of streptomycin-resistant E. coli, you would require to pick a colony of the bacteria from the streptomycin-positive plate and allow to grow it on a streptomycin-positive plate.

To learn more about E. Coli, refer to the link:

brainly.com/question/9046057

#SPJ4

3 0
1 year ago
What is the function of nervous tissue for transport within an organism?
julsineya [31]

Answer:

C

Explanation:

To send signals to the blood vessels to constrict or dilate , to increase or decrease blood flow respectively.

3 0
3 years ago
No links! pls help
defon

Answer:

I believe its primary succession

Explanation:

3 0
3 years ago
Which structure is labeled X in the diagram below?
Vladimir [108]

Answer:

Option D

Explanation:

Diagram is attached.

Capsid protein is a form of structural protein which usually forms part of a complex which later produces protective shell around the nucleic acid in a virus. It is also referred to as coat protein or head protein.  

Capsid acts as a distinguishing feature for identifying an integrated viral genome, plasmids and other genetic material of viruses. In fact, viruses are termed as organisms that encode capsid proteins.  

Hence, option D is correct

4 0
3 years ago
Cabbages have 18 chromosomes. How many chromosomes do each of the daughter cell produced by mitosis have?
AVprozaik [17]
This is because daughter cells are identical to the original cell.
Although during the process of mitosis the number of chromosomes changes, the final number of chromosomes in each daughter cell is always the same number as were in the original cell.
7 0
3 years ago
Other questions:
  • What effects would El Niño most likely have on organisms?
    9·1 answer
  • The most abstract plans depend on the _____ areas of the frontal lobes, and the most concrete plans depend on the _____ areas of
    12·1 answer
  • A smoker sees his doctor because he had a persistent cough for months and is short of breath after very little exertion. what di
    7·1 answer
  • What is translocation?​
    14·2 answers
  • The type of waste in most landfills is ​
    13·1 answer
  • According to Erikson's theory of psychosocial development, a child learns to be independent in the __________ stage.
    12·2 answers
  • What popular food product is obtained from a highly poisonous root that locals call manioc
    11·1 answer
  • Briefly explain y genetic variation is important to living organisms <br><br>plz help​
    11·1 answer
  • What does this sequence What does this sequence illustrate?
    9·2 answers
  • I’ll really appreciate it if you help me out with these 2 questions .
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!