1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DerKrebs [107]
3 years ago
5

Assume that some members of an aquatic species of motile, photosynthetic protists evolve to become parasitic to fish. They gain

the ability to live in the fish gut, absorbing nutrients as the fish digest food. Overtime, which of the following phenotypic changes would you expect to observe in the population of protists?
a.) gain of meiosis
b.) loss of mobility
c.) loss of chloroplasts
d.) no changes would be expected
e.) gain a rigid cell wall
Biology
1 answer:
Elodia [21]3 years ago
5 0

Answer:

c.) loss of chloroplasts

Explanation:

Chloroplasts are the double membrane-bound organelles of photosynthetic eukaryotes and serve as the site for photosynthesis. The organisms that can carry out photosynthesis make the organic nutrients and do not depend on other organisms for food.

According to the given information, the photosynthetic protists become parasite in fish and start deriving nutrition from the host. If the protists continue to survive as a parasite to fish, the chloroplasts will be rendered non-significant. The parasitic mode of nutrition does not require chloroplasts and therefore, the protists would lose the organelles over generations.

You might be interested in
A common feature of all organisms in the animal kingdom is that they are?
torisob [31]

They're all common in the fact that they have to eat others that have energy, because they in themselves cannot produce their own energy. All animals are multicellular.

6 0
3 years ago
Why must the cell move things in and out of it?
Varvara68 [4.7K]

Answer:

Moving things in and out of the cell is an important role of the plasma membrane. It controls everything that enters and leaves the cell. There are two basic ways that substances can cross the plasma membrane: passive transport, which requires no energy; and active transport, which requires energy.

7 0
3 years ago
Which kind of organism is found at the end of a food chain?
ad-work [718]

Answer:

A decomposer is found at the end of a food chain.

3 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
An allele is a form of a gene. In the cross HhSs x hhss, how many alleles does the kitten inherit from the father?
Elina [12.6K]
WhAt is tjis I’m so confused
3 0
4 years ago
Other questions:
  • What are the differences among hormones, enzymes, and vitamins?
    15·1 answer
  • Any one of you at least answer one question please?
    9·2 answers
  • During an expedition, a scuba diver saw an animal use stinging tentacles to capture and eat its prey. Which animal did the diver
    14·2 answers
  • Drosophila eye color is an X-linked trait. Red eye color is dominant, and white eye color is recessive. Which Punnett square sho
    5·1 answer
  • The scientific method is limited to investigating phenomena that are
    5·1 answer
  • 2. Which take deoxygenated blood back<br> to the heart?<br> O veins<br> O arteries<br> O capillaries
    6·2 answers
  • The solar system formed from a(n)_________, which is a rotating cloud
    9·1 answer
  • A short paragraph that explains how the ATP cycle works
    13·1 answer
  • 24. What is the total magnification of this compound microscope using the low power objective
    9·1 answer
  • the muscular tube between the stomach and the large​ intestine, divided into the​ duodenum, the​ jejunum, and the​ ileum, is​ th
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!