1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kap26 [50]
4 years ago
13

What is sideline? what is lorenzine ampoule?

Biology
1 answer:
bazaltina [42]4 years ago
3 0

Answer:

A sideline is an activity done in addition to one's main job, especially to earn extra income.

Lorenzini ampoule is a special sensing organ. They are mostly found in cartilaginous fish

Explanation:

If you have any questions feel free to ask in the comments.

You might be interested in
A woman with hemophilla and a ma hemophilla? n without hemophilia are expecting a baby boy. What are the chances that their son
SVETLANKA909090 [29]
A zero percent chance that the son will have hemophilia and a 100 percent chance that the son will be a carrier for hemophilia
8 0
3 years ago
Question 14 unsaved unlike endocrine glands, exocrine glands question 14 options: release hormones. release secretions directly
Ugo [173]
Exocrine glands release secretions outside of the body.

One way to remember this is:
exo = outside  
endo = inside

An example of an exocrine gland is a sweat gland. They release sweat (an excretion) to the outside of your body.

I hope this helps! I'm happy to answer any other questions you might have :)
5 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Select all that apply: Nucleic acids _____.
Marat540 [252]
I would believe the correct responses would be option 1,2,4.
5 0
3 years ago
Read 2 more answers
Which electron carrier is used in the redox reactions in cellular respiration?
Gre4nikov [31]
NAD is the electron carrier which is used in redox reactions in cellular respiration
5 0
3 years ago
Read 2 more answers
Other questions:
  • Ultraviolet light has what effect on the bilirubin molecule?
    14·1 answer
  • One of the most common types of bacteria-related diarrhea in the united states, resulting primarily from the ingestion of contam
    15·1 answer
  • Which best describe the structure of DNA?​
    13·1 answer
  • Which statement is true about fossils?
    13·2 answers
  • What do you think would happen to a jellyfish if it were placed in a freshwater lake?
    5·1 answer
  • Mako sharks weigh about 1000 pounds when they reach maturity. Suppose that in a gulf near South America, the following food chai
    11·2 answers
  • Why is it difficult to study the genetics of humans?
    5·1 answer
  • A cell is most likely to be a plant cell if it contains: O A. chloroplasts and a cell wall. B. RER and SER. O C. mitochondria an
    13·2 answers
  • In what other parts of a plant might transpiration occur?​
    13·1 answer
  • Experiment: The viscosity of a liquid is its resistance to flow. Ketchup and honey, for example, have a greater viscosity than w
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!