1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sloan [31]
3 years ago
15

What is the "uncondensed" genetic material called? chromatin centromere

Biology
1 answer:
Verdich [7]3 years ago
7 0
The "uncondences" genetic material isn't centromere, it's chromatin bro!
You might be interested in
Suppose a researcher wants to know whether a high protein diet causes children to learn better in school. half of the children i
denis-greek [22]

the control group would be the children eating their normal diet

8 0
4 years ago
Mitochondria differ from chloroplasts in that mitochondria a. contain three different membrane-bound compartments, whereas chlor
Anika [276]

Answer:the answer is b:contain membrane folds called cristae, whereas chloroplasts contain disk-like vesicles in stacks called grana.

Explanation:

7 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
The phenomenon of one gene being responsible for or affecting more than one phenotypic characteristic is
AlekseyPX
Pleiotropic is the answer

5 0
4 years ago
______ is a source of genetic variation that involves the swapping of sections of chromosomes during meiosis
lara [203]

Answer:

Crossing over.

Explanation:

I do believe that is the correct answer.

7 0
3 years ago
Other questions:
  • Immune surveillance is a process in which ____________ nonspecifically detect and destroy foreign cells and diseased host cells.
    5·1 answer
  • Which type of cell lines the cavities and surfaces of blood vessels and organs? neuron epithelial cell muscle cell blood cell
    7·2 answers
  • Which advance resulted from the development of a culture technique for muscle cells?
    15·2 answers
  • When water vapor condenses how much heat energy will be released into the atmospher
    14·1 answer
  • Which unit of measurement is used in the metric system?
    15·2 answers
  • Which is an external stimulus? <br> A. Thirst <br> B. Hunger <br> C. Pain <br> D. Heat
    14·2 answers
  • Certain drugs, known as angiogenesis inhibitors, are effective anti-cancer drugs because they cut off the blood supply to tumors
    9·2 answers
  • I need help with thiiss
    15·1 answer
  • 17. What generates the power in your home?
    10·2 answers
  • What roles do species plan in ecosystem?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!