1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
8

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

nd sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion
Biology
1 answer:
frozen [14]3 years ago
4 0

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

You might be interested in
The Hawaiian Islands are home to many endangered species. Why do you think the Hawaii Department of Agriculture is so strict abo
zysi [14]
Because these non native species can cause competition for the same food source as the native species thus making it harder for the native species to survive. Also the non native species could see the native species as food causing them to die out. As well as introducing new diseases that these native species don’t know how to defend themselves from
4 0
3 years ago
What problems are experienced by fresh water and marine fish in there habitats and how they overcome it
stich3 [128]

ANSWER:

Problem faced include; habitat loss and degradation, disease outbreak, invasive species, pollution, over‐exploitation/overfishing, climate change etc.

EXPLANATION:

Problem:

Habitat loss and degradation, disease outbreak, invasive species, pollution, over‐exploitation/overfishing, and climate change are notable problems experienced by freshwater and marine fishes.

Solution:

Anthropogenic activities and stressors that rapidly threaten freshwater and marine fishes are curbed through legislation and other means to prevent extinction of fishes.

Through conservation programs that plans for individual species to more species of entire faunas of a particular location also boost population size and prevent hunting of threatened or endangered species in both realms.

Overtime, genetically modified fishes which can develop resistance to diseases are introduced to the realm.

Moreso, waste channels through which pollutants gets into the water bodies are well-treated for safety of fishes.

3 0
3 years ago
What will likely happen if a plant does not receive any sunlight for a week?
Alika [10]
It will B - begin to die
6 0
3 years ago
Starting from the sun, create a food chain including at least three organisms. Explain how energy is transferred through the cha
Kryger [21]

Answer:

The food chain showing seven organisms can be drawn as follows:

Plants → grasshoppers → mice → frog → snakes→ eagles → decomposers

The plants are the primary source of food in a food chain or a food web. The animals which feed on plants will be termed as herbivores or primary consumers like the grasshopper. The organisms feeding on primary consumers will be the secondary consumers like mice.

An energy pyramid for three of the organisms can be shown as follows:

              mice (10 kilocalories)

                   ↑

        Grasshoppers (100 kilocalories)

                   ↑

       Plants ( 1000 kilocalories)

As the energy pyramid shows, only about 10% of the energy travels from one trophic level to another.

Explanation:

6 0
2 years ago
Where does the energy for photosynthesis come from?
Lunna [17]

answer: The raw materials of photosynthesis, water and carbon dioxide, enter the cells of the leaf, and the products of photosynthesis, sugar and oxygen, leave the leaf.

Explanation:

hope this help

3 0
3 years ago
Other questions:
  • Please for the love of god i need help..
    13·1 answer
  • A____ is a horizontal stem at or just beneath the surface of the ground which can give rise to roots or stems.
    13·2 answers
  • Gene flow or migration is the transfer of alleles or genes from one population to another. Select the combination of facts that
    15·2 answers
  • Is glucose more or less complex than the rest of the biomolecules ?
    10·1 answer
  • What evidence did Wegener make use of to develop the theory of continental drift?
    13·2 answers
  • Which of the following units of measure should be used to measure the length of an automobile?
    5·1 answer
  • In general, the muscles of the anterior compartment of the forearm tend to extend the wrist and fingers, while muscles in the po
    10·1 answer
  • HELP!!!
    8·1 answer
  • I'll cashapp you 10$ if you help me with my test​
    7·1 answer
  • I need the answer pls don’t tell the wrong answer and this is science
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!