1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
8

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

nd sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion
Biology
1 answer:
frozen [14]3 years ago
4 0

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

You might be interested in
D.SMALL INTESTINE 1. Name the building blocks of each major class of nutrients: complex carbohydrates (AKA polysaccharides like
Dima020 [189]

Answer:

Explanation:

1. Complex carbohydrates (AKA polysaccharides like starch)- monosaccharides linked together by glycosidic linkages

Fats (AKA triglycerides) - Fatty acids

Proteins- Amino acids.

2. Name the 3 portions of the small intestine in order - The Duodenum, Jejunum, and Ileum.

3. In which of these 3 portions does the greatest amount of nutrients absorption occur - Jejunum

6 0
2 years ago
Which of the tables correctly identifies the pictures below?
FrozenT [24]
The answer I think is A
6 0
3 years ago
State the sructure of transpiration and guttation and both where the occur​
Rama09 [41]

Answer:

Transpiration is loss of water from the surface of leaves in the form of water vapour while guttation is exudation of water from the surface of leaves in the form of drops. Transpiration takes place through stomata while guttation takes place through hydathodes.

Guttation usually occurs at the margins and the tips of the leaves. Transpiration occurs throughout the general surface of the leaves and the young stems.

Explanation:

8 0
3 years ago
How are DNA and cellular reproduction linked in the process of inheritance?
Sunny_sXe [5.5K]
Inheritance is the process by which traits are passed from the parents to their offspring. The basic unit of inheritance in human is the DNA. For traits  to be passed from the parent to the offspring, the DNA in the cell must be duplicated and this happens through the process of cellular reproduction.
8 0
3 years ago
 Which of the following is least likely to be an effect of global warming?
allochka39001 [22]
Decreased rate of photosynthesis in vegetation
3 0
3 years ago
Other questions:
  • Darwin had very few fossils to support his theory of evolution by means of natural selection when he published On the Origin of
    6·1 answer
  • Veins have a much lower blood pressure than arteries. Which of these prevents backflow of blood in veins?
    13·2 answers
  • Which sentence describes an example of sublimation
    14·2 answers
  • Which type of limiting factor affects a large population more than it affects a small population?
    7·2 answers
  • 1.True or false? Gametogenesis is the same as meiosis?
    14·1 answer
  • As a weather balloon released from the surface of earth rises through the troposphere the instruments it carries will usually in
    6·1 answer
  • Darwin focused on studying specific species on the Galapagos Islands and other places and observed
    15·1 answer
  • g Bacterial genomes contain small transposable elements termed ____________ that resemble transposons of eukaryotic cells.
    12·1 answer
  • Explain how ionic balance is maintained in the human body​
    8·2 answers
  • In this course, you will learn about hormones and their effects on cells. Certain hormones bind to receptors at the plasma membr
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!