1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
8

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

nd sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion
Biology
1 answer:
frozen [14]3 years ago
4 0

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

You might be interested in
Aaron has pre-hypertension. to help lower his blood pressure, he should consume foods that are high in
Anna [14]
Potassium and can be obtained by eating avocados, acorn squash, sweet potato, spinach etc..
4 0
3 years ago
How do the resurection of fern, crysts of brine shrimps and tardigrade survive with no water?
ehidna [41]
They survive without water by entering a special mode, otherwise called as shriveling. They can lose even 95% of water in their body and still live, even though they would look like dead plants, they would actually be alive. In the absence of water, tardigrades use a sugar called trehalose, which becomes their source of life until they find some water.


8 0
3 years ago
9) Genetic variation is the source for evolution. Without a variety of phenotypes, there would be no differential survival upon
Firlakuza [10]

The genetic variation occurs due to induced changes to the genome from environmental factors, fertilization of two haploid gametes during gamete fusion. The correct options are D and E.

<h3>What is genetic variation?</h3>

The presence of differences in gene sequences between individual organisms of a species is referred to as genetic variation. It allows for natural selection, which is one of the primary forces driving life's evolution.

The genetic variation occurs due to induced changes to the genome from environmental factors, fertilization of two haploid gametes during gamete fusion.

Thus, the correct options are D and E.

For more details regarding genetic variation, visit:

brainly.com/question/848479

#SPJ1

3 0
2 years ago
Read 2 more answers
What is least likely to be an example of a variation within a species ?
Ket [755]

Answer:

Option D,  Number of limbs

Explanation:

Options for the question

a. Birth weight

b. Hair color

c. Number of offspring

d. Number of limbs

Solution

Variation within a species is caused due to genetic differences governed by varying allele frequencies and duet to environmental factors that somewhere effect the expression of the genetic potentials thereby causing phenotypic variation.  

Number of limbs is a physical characteristics, very unlikely governed by genetic variation. While factors such as hair color (grey, black, white etc.), height (tall, short, medium) etc. are governed by genetic variation as a result of which they have several phenotypic variations.

Hence, option D is correct

7 0
3 years ago
What percent of the sunlight is actually converted into chemical energy via photosynthesis?
kirill115 [55]

Photosynthesis is a process in which green plants and few organisms use sunlight to synthesize their food from carbon di- oxide and water. In plants, during photosynthesis, green pigment known as chlorophyll is involved and oxygen is generated at a by product.

All the sunlight falling on plant is not absorbed. Only half of the falling light which lies in the right frequency to power photosynthesis is absorbed. Out of this falling light, only 8 % to 11% is absorbed by the plant and only 3 % to 6 % is actually used to form chemical energy.

4 0
3 years ago
Other questions:
  • Which of the four basic substances on this ph scale is slightly basic?
    14·1 answer
  • A scientist is observing ___ when he or she is following a series of steps to solve problems.
    14·2 answers
  • Can anyone explain the development stages of foetus in ownwords/understanding?
    11·1 answer
  • Once meiosis occurs gametes are formed with a reduced number of chromosomes. The gametes are
    10·1 answer
  • Please help!!! Owls and hawks both eat rodents. They are also found in the same habitats. Since no two populations can occupy ex
    10·1 answer
  • What are body systems composed of ​
    15·1 answer
  • Approximately what wavelength of light is best absorbed by chlorophyll a, the pigment that participates directly in the light re
    9·1 answer
  • What does an urn-shaped age pyramid represent? A. a stable population growth B. a low birth rate C. a low death rate D. a growin
    8·1 answer
  • 1 point
    7·1 answer
  • What is the geosphere?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!