1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
8

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

nd sequence the DNA. After entering your sequence into BOLD the following comparison comes up.Species 1. ATGCAAATTTGGGCATCCGAATGGTTGCAASpecies 2. ATGCAAATTTTTTGGGCATCCGAATGGCAAWhat DNA modifications have occurred in Species 2 that makes it different from Species 1? Check all that apply.a. Inversionb. Duplicationc. Deletion
Biology
1 answer:
frozen [14]3 years ago
4 0

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

You might be interested in
Which of these structures forms a complete ring around the airway?hyoid bonetracheal cartilagecricoid cartilagethyroid cartilage
Lubov Fominskaja [6]

Answer: cartilage

Explanation: because it is not hard or soft but it still is bone and that is what your ears and nose is made of

8 0
3 years ago
Read 2 more answers
What is Nondisjunction<br> and when does it happen?
dimaraw [331]

Answer:

I is when two or more chromosomes fail to separate, which makes daughter cells with abnormal amounts of chromosomes

Explanation:

Your welcome.

5 0
3 years ago
The brackets are indicating a(n) _____ bond.
Wittaler [7]

Answer:

The correct answer choice is B

Explanation:

We use these brackets in the first place to show the main molecule interconnection with other appendage molecules. For example, Ca(OH)2. The main molecule of calcium is joined with other two molecules and  brackets are showing interconnection simply. However, these brackets can't tell us about the orientation and position of bond in 3D space. We have to utilize stereo-chemistry for that...

8 0
3 years ago
In a dihybrid cross involving two autosomal traits on different chromosomes in which the parents are purebred for the opposite f
Simora [160]

Answer:

The question lacks options, the options are:

A) 1 out of 16

B) 3 out of 16

C) 6 out of 16

D) 9 out of 16

The answer is 1 out of 16

Explanation:

This is a DIHYBRID cross because it involves two different genes coding for distinct traits. One of the traits will be dominant while the other recessive. Hence, parents that are purebred for opposite forms of the trait means that one parent is homozygous dominant while the other is homozygous recessive. When these two parents cross, they produce F1 offsprings that all possess the dominant trait but heterozygous/hybrids.

When these hybrids are self-crossed, they produce four different combinations of gametes which when crossed using a punnet square will result in F2 offsprings with a 9:3:3:1 phenotypic ratio according to Mendel's observation.

9 represents offsprings that are dominant for both traits

The two 3's represents offsprings that are recessive for one trait and dominant for the other respectively.

1 represents offsprings that are homozygous recessive for both traits.

Hence, 1 out of 16 offsprings will be homozygous recessive for both traits.

4 0
3 years ago
When Lactate Builds Up In A Runner's Muscles, It Causes A Burning Sensation. What Causes This To Occur?
Fantom [35]

One of the most general forms of discomfort or pain one feels at the time of strenous work out is a burning sensation in the muscles or lungs, which goes away after some time, that is, after stopping the activity. This is a result of an accumulation of lactic acid.

Lactic acid is a by-product of the procedure the body goes through when it requires to generate energy more briskly that it does usually, like when one exercises.

The muscles functioning generally produce energy aerobically, that is, by using oxygen, however, when one push himself or herself at the time of workout and enough oxygen is not accessible, then these muscles start producing energy anaerobically, resulting in production of lactic acid as a by-product and ultimately causing burning sensation.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Why are forest considered biodiversity hotspots ?
    5·1 answer
  • Scientists discovered that the Albert's squirrels became two separate populations during the Grand Canyon's formation; they are
    13·1 answer
  • How are the chicken wing and human arm similar, different, and how they are adapted to allow the organism to survive in their en
    11·1 answer
  • eggs are used in alot of baking goods eaten over thanksgiving. eggs only have one set of chromosomes. list three vocabulary word
    5·1 answer
  • I need help!
    11·2 answers
  • A cell that is undergoing mitosis is examined with a light microscope. An observation that would allow for identification of the
    6·1 answer
  • The organism at location D is the _______ to<br> organisms at location A, B, and C.
    7·2 answers
  • The brain and spinal cord comprise the ______________ nervous system. the neurons that link the brain and spinal cord to the bod
    14·1 answer
  • Select all of the ways that a fossil could get destroyed before being
    8·1 answer
  • PLEASE HELP EMERGENCY!! IF YOU ARE NOT 100% SURE ABOUT YOUR ANSWER DO NOT ANSWER THEN!! PLEASE!!
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!