1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
4 years ago
12

Help me please!!20 points!

Biology
2 answers:
scoundrel [369]4 years ago
8 0
Heat could cause water evaporation and cold climate could cause freezing
Klio2033 [76]4 years ago
4 0
I am sorry I wish I could help you. Sorry
You might be interested in
List the inputs and
Nutka1998 [239]

Answer:

Photosynthesis Inputs. 6H2O, 6CO2, (light) energy.

Photosynthesis Outputs. C6H12O6 (glucose), 6O2.

Light Reactions Inputs. Light (energy), ADP, Pi, NADP, H2O.

Light Reactions Outputs. O2, ATP, NADPH.

Calvin Cycle Inputs. CO2, ATP, NADPH.

Calvin Cycle Outputs. G3P.

Explanation:

4 0
3 years ago
Compare the roles of the phospholipid bilayer in passive and active transport.
morpeh [17]

Answer:

Phospholipid bilayer determinates which molecules can enter or exit the cell so its purpose is to be a checker in the middle. Cell membrane determinates the structure of the cell and it is the connection to the rest that happens in a cell.

Explanation:

Molecules can move in 2 ways: passive and active.

The only difference is the energy that is needed to do the movement.

In passive mechanisms, energy is not used, while in active transport, energy is needed. Diffusion or passive transport are moving the concentration from hight to low so the energy is not necessary. Active transport moves from low to a high concentration and it uses metabolic energy.

4 0
3 years ago
Every november, tens of thousands of sally lightfoot crabs on christmas island leave their rain forest habitats at the same time
Charra [1.4K]
The type of fertilization that one would expect to find in this specie is EXTERNAL FERTILIZATION. External fertilization is the type of fertilization in which the male sperm fertilize the female eggs out of the female's body. This type of fertilization usually occur in aquatic environment. 
4 0
3 years ago
Read 2 more answers
Asking questions will help guide you as you research the topic. Here are some sample questions to get you started: What is the d
Brrunno [24]

Answer:

ok¿kkkkkkkkkkkkkkkkkkkk

7 0
3 years ago
If a person develops high blood pressure, one of the compensatory mechanisms that comes into play is the fluid shift mechanism.
ra1l [238]

Answer:  shift

Explanation:

4 0
3 years ago
Other questions:
  • What is the most important feature of an enzyme​
    13·1 answer
  • 50PTS and brainliest!
    13·2 answers
  • What gets wetter & wetter the more it dries?
    15·2 answers
  • A scientist found a new bacteria in a hot water sulfur spring that uses sulfur as a source of energy instead sunlight. What kind
    15·2 answers
  • Which molecule is classified as organic?
    6·1 answer
  • What are some different characteristics of the varicella virus (chickenpox)?
    5·1 answer
  • Can someone help!!even one of these questions...plzz<br>15 points​
    5·1 answer
  • Which wavelengths of sunlight care the most energy
    12·1 answer
  • What are the two reasons that there are exceptions to Mendelian heredity?
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!