1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skad [1K]
4 years ago
5

How many chromosomes are in a human gamete (of a human body cell has 46?

Biology
1 answer:
Elanso [62]4 years ago
6 0
23, half of the total. This is because a zygote receives 23 from the mother and 23 from the father. 
You might be interested in
How are autosomal traits usually inherited?
weeeeeb [17]

Answer: they can be either dominant or recessive

Explanation: due to the effects of one Gene are usually inherited in a simple mendelian pattern.

6 0
3 years ago
Read 2 more answers
Will give the brainliest!
Alexxx [7]
<h2>°·.¸.·°¯°·.¸.·°¯°·.¸.->    Answer     >-.¸.·°¯°·.¸.·°¯°·.¸.·° </h2>

When heat is added to a solid, its particles move _______

A. faster

B. slower

C. closer together

<em>D. the same speed</em>

<h2>(っ◔◡◔)っ ♥ Answer ♥</h2>

A. (I THINK-)

<h2>Explanation</h2>

When heat is added to an object, the molecules vibrate faster. As they go faster, there is more space in between the molecules.

<h2>¸,ø¤º°`°º¤ø,¸¸,ø¤º° Details °º¤ø,¸¸,ø¤º°`°º¤ø,¸ </h2>

Subject: Science

Unit: Atoms, Molecules,

Grade: 5-7

(I think I might be wrong-)

4 0
3 years ago
Which cell structure is found in plant cells, but not in animal cells?
rewona [7]
Plant cells have a cell wall so answer 1
8 0
3 years ago
Read 2 more answers
Blood pressure is determined by which of the following components?
mixer [17]

The answer is that the strength of heart contraction and blood volume. It is affected by blood volume, stroke volumes, total peripheral resistance, and HR. It has Increase in any of these will increase blood pressure. Vasoconstriction of arterioles raises blood pressure upstream in the arteries

7 0
3 years ago
Read 2 more answers
Which carbon compounds are formed over the course of the Calvin cycle? In what form of sugar to cells
Airida [17]

Answer:

xyxxuxuuxcu

Explanation:

xyyxyxxy

5 0
3 years ago
Other questions:
  • What is a cell how does it effect the body
    12·2 answers
  • What kind of chemical bonds are found between paired bases of the dna double helix?
    9·1 answer
  • Which of the following includes all of the levels of organization?
    10·1 answer
  • At a specific area of a chromosome, the sequence of nucleotides below is present where the chain opens to form a replication for
    6·1 answer
  • An agency that is heavily involved in combating medicare and medicaid fraud is ____
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • With respect to the enzyme that converts x to y, substance a functions as _____.
    15·1 answer
  • This is a monomer (building block) of which biomolecules
    9·1 answer
  • What do lung cancer And emphysema have in common
    7·2 answers
  • Which of the following animals are examples of vertebrates? 
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!