1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kisachek [45]
3 years ago
11

What are the trade-offs of using insecticides to kill mosquitoes?

Biology
1 answer:
olga2289 [7]3 years ago
7 0
This can select for resistant mosquitoes. After a couple of years, the population is entirely resistant to the insecticides you used. The insecticides may also kill off the beneficial insects (like pollinators e.g. bees) or the predator insects that ate the mosquitoes. Bioaccumulation and biomagnification in the food chain can lead to unintended deaths of high-level predators, e.g. DDT leading to deaths of eagles and falcons. I hope this is correct. 

You might be interested in
What has left tons of "space junk" in orbit around the earth? "Pick One"
satela [25.4K]
The answer is B and I need 20 characters so I am typing random words
6 0
3 years ago
DNA fingerprinting is a laboratory technique used to establish a link between biological evidence and a suspect in a criminal in
Julli [10]
No. none of the children have the markers for als
4 0
3 years ago
Read 2 more answers
Which of the following is NOT a limiting factor for animals in an ecosystem?
TEA [102]

Answer:

4

Explanation:

because it needs all the other stuff

6 0
2 years ago
Read 2 more answers
Which statement describes a similarity between asexual reproduction and sexual reproduction?
alexgriva [62]

Answer:

B

Explanation:

7 0
3 years ago
Read 2 more answers
WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
stiv31 [10]

Answer:

C

Explanation:

Thats the tea

Hope this helps ;)

4 0
3 years ago
Other questions:
  • If my cousin proposed to his girlfriend, and she is now his finance, when they get married, What is her relation to me?
    10·2 answers
  • The organ that supports the plant body and carries nutrients between different parts of the plant is the
    11·1 answer
  • Which of the following properties of life is likely NOT to be a common
    9·2 answers
  • 2. What purpose does fat serve in the body?
    14·1 answer
  • Do asian and indian share the same ansestors
    11·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What machines and tools are being used for farming nowadays?​
    7·1 answer
  • Heat from the sun travels to earth by what
    8·1 answer
  • 50 points help help help quick the test is timed
    9·1 answer
  • Carbohydrates are a huge source of...
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!