1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hammer [34]
3 years ago
10

If I am in level virtuoso and I can send direct message but to whom I am sending has not completed that level. Then too will I b

e able to send message? Or he/she will receive message?​
Biology
2 answers:
PIT_PIT [208]3 years ago
8 0

Answer:

Even if you aren't friends with that account, I believe they will be able to receive the message. :)

Explanation:

Alex Ar [27]3 years ago
4 0

Answer:

May be facility of inbox messaging is not available to all

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Column A
Alex_Xolod [135]
One and the letter D
4 0
3 years ago
The brain waves that predominate at any given time depend on a person’s state of consciousness. false true
cluponka [151]

True. The brain have different waves that occur at every stage of consciousness. For instance, when the individual is in awake state, beta waves are associated.Thank you for your question. Please don't hesitate to ask in Brainly your queries. 
8 0
3 years ago
Read 2 more answers
This is my question :>
Colt1911 [192]
The answer is 23 chromosomes.
5 0
3 years ago
Read 2 more answers
What is the relationship between he motion of molecules and the kinetic energy of the particles? PLS IT IS IMPORTANT!
Rina8888 [55]

Answer:

an increase in the temperature will increase the average kinetic energy of the molecules which causes the molecules to move faster

7 0
3 years ago
Other questions:
  • What precautions can be taken to increase the safety of a structure in an earthquake prone area?
    13·1 answer
  • According to the RNA World hypothesis, which of these tasks was accomplished by early RNA, but is not generally accomplished by
    7·1 answer
  • Can someone please help me I need it
    14·1 answer
  • Bones that join together and are held in place with sheets of collagen between the bones are called ____________ ,
    5·1 answer
  • What is the purpose of atp in both cellular respiration and photosynthesis?
    11·1 answer
  • Does the food chain model or the food web model show more biodiversity? Why?
    12·2 answers
  • 4. Even after one drink, people have
    15·1 answer
  • You are to create a story for a child of 5-6 years old. You will explain the brain and its functions to them. You need to use th
    6·1 answer
  • What is the role of platates​
    14·2 answers
  • Can someone please help me!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!