An internal membrane system where lipid components of the cell membrane are assembled, along with proteins and other materials

1 answer:

3 0

A. Lipid bilayer: the phospholipid bilayer is the membrane of a cell. The bilayer contains lipids, membrane proteins, cholesterol, receptors for various molecules, pumps to transport ions and solutes against the concentration gradient, and many other items necessary for a cell to function and work together with other cells.

b. Osmotic pressure: Osmosis is the flow of water across a semipermeable barrier from an area of low solute concentration to high solute concentration. Osmotic pressure is the lowest possible pressure to prevent this water movement.

c. Endoplasmic Reticulum: the Rough ER synthesizes proteins for use outside the cell. The Smooth ER produces lipids and some steroidal hormones.

A. Lipid Bilayer is therefore the correct answer. Osmotic pressure does not involve the various components of the cell membrane, and the ER's produce proteins and hormones. Therefore A is right.

Hope this helps! :) Let me know if you need a clarification.

You might be interested in

What is mitochondria

vesna_86 [32]

<span>an organelle found in large numbers in most cells, in which the biochemical processes of respiration and energy production occur. It has a double membrane, the inner layer being folded inward to form layers (cristae). </span>

4 0

2 years ago

Read 2 more answers

A single layer of irregularly shaped epithelial cells found lining the respiratory tract is called

ValentinkaMS [17]

Diptheria. go see your doctor.

7 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved