<span>an organelle found in large numbers in most cells, in which the biochemical processes of respiration and energy production occur. It has a double membrane, the inner layer being folded inward to form layers (cristae). </span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Emphasis made of finding cost effective ways to reduce air pollution.
Answer: Control Group is like a regular experiment
Explanation: Example:
A drop of mint juice with a mint gum will strengthen your breath.
Control Group- Mint gum
Independent Variable- Mint juice.
Dependent Variable- Breath (Being measured)