1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
luda_lava [24]
4 years ago
11

How is your community like the human body, give two examples

Biology
2 answers:
vazorg [7]4 years ago
8 0
In a community everyone works together to form a whole also community's have many different important parts that we need to function
Svetllana [295]4 years ago
6 0
We all need to work together, I think is one. Can't really think of another example though.. sorry
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Mrs. smith has blood type
Degger [83]
1/3 probability would be the answer
3 0
3 years ago
Why do we add detergent to the strawberries? Group of answer choices To dissolve proteins that are found on the DNA molecule and
alukav5142 [94]

Answer:

The correct answer is - To dissolve the cell and nuclear membranes and release the DNA.

Explanation:

The major function of the detergent in DNA extraction is to dissolve the cell and cellular membranes. It can increase the membrane permeability by pulling apart lipids and proteins that are components of the nuclear and cellular membrane and lyse the cell, from which we want to extract the DNA.

Detergents cause pores in the cell membranes and once these membranes are completely lysed the DNA is released from the cell. It is similar to detergents removes fat (lipids) from dishes.

5 0
3 years ago
A person high on the trait of __________ will typically follow a script, or a perceptual and behavioral strategy, that involves
ddd [48]

Answer:

The preferable option will be - C.

agreeableness, agreeable.

Explanation:

  • A person who has an alternative character of <u>agreeableness</u> will typically follow a script, or a cascade of perceptual and behavioral strategy, that involves being warm, friendly, approachable, and slow to anger.
  • If a person is <u>agreeable</u>, then he or she will probably not get angry in response to a mild insult.

So, we can say that an agreeable person is more calmer than an agreeableness person.    

7 0
3 years ago
Why does ice float on water?
laila [671]
C.The density of ice is less than the density of water.
3 0
4 years ago
Other questions:
  • The total volume of the brain is approximately _____ glial cells.
    11·2 answers
  • Innate immunity includes all of the following EXCEPT
    6·1 answer
  • Given that the dna molecules all have similar charge to mass ratios, what property do you think is most important in determining
    5·1 answer
  • Why is it important to use greek or latin words for scientific names?
    13·1 answer
  • If you live in the city and head out to a rural town, the _____ suggests the rural area's temperature would be _____. rain shado
    14·1 answer
  • Why is wind erosion so harmful?
    10·2 answers
  • I will give the Brainiest to the first one that is reasonable
    11·1 answer
  • When Jenner developed the first vaccine he was using the observation of milk maids who
    5·2 answers
  • To ensure that a human gene is translated properly in a bacterial cell, you should clone the _____________ for the gene instead
    12·1 answer
  • HELP <br> How do we get glucose into our body?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!