1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
3 years ago
15

The absorption of alcohol can be slowed down by eating, but only __________ can reduce the BAL level. Sleep Water Coffee Time

Biology
2 answers:
xenn [34]3 years ago
6 0
<span>The answer is Coffee. Fatty foods will back off liquor retention fundamentally, as they adequately shape a covering that it can't without much of a stretch go through.However, sustenance in the stomach will likewise significantly accelerate the rate of gastric purging. This implies the liquor comes all the more rapidly into contact with the dividers of the upper segment of the small digestive system [the duodenum], through which it is retained significantly more effectively into the blood than it would be however the dividers of the stomach.</span>
krok68 [10]3 years ago
4 0
<span>When alcohol reaches the blood, nothing can be done to lower down the BAL levels. But, the absorption of alcohol can be reduced by consumption of the foods rich in starch, which will absorb alcohol from the blood, althogh only little. Rest of the acohol wil be cleared by the liver, after some time.</span>
You might be interested in
Describe how a zygote with trisomy 21 is likely to<br> occur during fertilization.
maks197457 [2]

Answer:

If the paired chromosomes fail to separate during meiosis in the female, then the resulting daughter cells will receive either 2 or no copies of chromosome 21. If the resulting egg with 2 copies of chromosome 21 is fertilized with a normal sperm, the resulting zygote with be trisomy 21

Explanation:

5 0
2 years ago
A cell with 36 chromosomes undergoes meiosis, how many daughter cells are created?
Novosadov [1.4K]

Answer:

hey!!

Explanation:

The answer is 36

Mitosis is a cell division that produces 2 cells daughter that are genetically identical to both the other daughter cell and the parent cell. The process where the parent cell first duplicates its genetic material, then it divide so that both daughter cell receive the exact number and same DNA.

Therefore, the answer is 36, only 36 matches the description of genetically identical cells.

7 0
3 years ago
Please some one help ASAP no links please
Ivahew [28]

Answer: I think it is c

Explanation:

8 0
3 years ago
A student wants to perform an experiment to test the effect of different colored lights on the growth of basil plants. She sets
Elena-2011 [213]

Answer:

light is the independent variable, height of the plant is the dependent variable. Dependent is the effect that based on the independent.

Explanation:

lets break it down. 1) you want to know the effect of something you apply from one thing to another. Let say, if you grow your plants under the sunlight, the plants grow taller. In this case, the sunshine is the independent variable whereas the height of the plant/how tall it can grow is the dependent variable. 2)NOW, before i give the answer. The design of the question is not good for high school students. i think your teacher thinks "light" is the independent variable. 3)However, the question contains confounding variables in it because different lights might produce different effects to the height of the plants. If you want to test if plants are exposed to light grows taller than plants do not expose to light, then you should have all the lights are the same. 4) So, all the plants should be exposed to one certain light to avoid confounding. Confounding means that either red light and sunlight are both produce the same effect whereas the other colors do not help the plants to grow taller. 5)Your teacher should test one light at a time. So, if he is testing with all different colors of light, then light is the independent variable, and height of the plant is the dependent variable.

4 0
3 years ago
During binary fission, DNA copies move to opposite ends of the parent cell. This process is most similar to which phase of mitos
stellarik [79]

Answer:

it is majorly seen in amoenw

8 0
3 years ago
Read 2 more answers
Other questions:
  • All life must maintain an internal balance, despite environmental changes.
    10·2 answers
  • Why do you need a global perspective when planning for sustainable energy?
    5·1 answer
  • What process is responsible for producing 2n zygote
    8·1 answer
  • There are several reasons why the skeletal system is unique. here are a few of the reasons:
    15·1 answer
  • A nurse is caring for a client receiving oxygen therapy. what is the expected reference range when obtaining oxygen saturation l
    11·1 answer
  • What are two properties of water that are caused by the attractions between water molecules
    5·1 answer
  • Can someone help me check these two if they are right?
    6·1 answer
  • The princess’s diary is a what source ?
    11·2 answers
  • Need help Plz!!!!
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!