1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
13

Several bodily responses are described below. For each response, determine what caused the change in

Biology
2 answers:
EastWind [94]3 years ago
8 0

Answer:

  1. Body starts to sweat: The core body temperature exceeded the set range of 35 degrees to 41.5 degree celsius
  2. Breathing rate increases: Cells are not receiving adequate oxygen to produce adequate energy.
  3. Amount of saliva produced changes: Saliva is produced in response to pH changes in the mouth or the intake of food.
  4. Body starts to shiver: Core temperature dropped below the set range of 35 to 41.5 degree celsius.

Explanation:

Homeostasis:

Homeostasis is the physiological process of regulating the internal environment of the body against fluctuations in the external environment.

Homeostasis systems in the body follow the following basic scheme (from 1 to 4):

  1. Stimulus
  2. Sensor
  3. Control
  4. Effector

Various control centers in the body sense varying body conditions and in turn activate certain effector mechanisms to regulate the changing conditions.

Thermoregulation:

  • Thermoregulation is the control and regulation of the optimum core temperature of the body between the range 35 to 41.5 degree celsius.
  • The control center is the hypothalamus, a part of the brain that receives signals from receptors in the body and initiates the appropriate response.
  • If the core temperature exceeds the optimum range, two mechanisms are initiated:
  1. The blood vessels towards the skin and extremities dilate, increasing the blood flow, allowing heat loss to the environment.
  2. Sweat glands are activated, evaporation of sweat produces a cooling effect.
  • If the core temperature decreases, again, two mechanisms are activated:
  1. Blood vessels to the extremities constrict to prevent heat loss; those towards the core dilate to provide maximum heat to the internal organs.
  2. Shivering mechanisms (involuntary muscle contractions) are activated that generate heat.

Respiratory Homeostasis:

During exercise or strenuous physical activity, our cells need to produce a large amount of energy through cellular respiration. Since, cellular respiration requires oxygen, more and more oxygen needs to be supplied to the cells. A low oxygen signal detected by the hypothalamus (control center in the brain) increases the breathing rate to ensure that sufficient oxygen reaches the cells.

Oral homeostasis:

The salivary glands maintain the homeostasis of the oral cavity. Saliva is not produced in response to food but to maintain the pH of the oral cavity to protect the teeth and enamel. Saliva contains the enzyme amylase which digests carbohydrates in the mouth. Therefore, the production of saliva increases in response to smell, sight and taste of food.

lubasha [3.4K]3 years ago
8 0

Answer:

1.change in temperature

2.lack of oxygen

3.need for water

4. change in temperature

hope its helps

Explanation:

You might be interested in
The heart is the major organ of the circulatory system. Which part of the body is responsible for delivering de-oxygenated blood
aksik [14]

Answer:

The inferior vena cava is the largest vein in the body and carries deoxygenated blood from the lower half of the body into the heart.

Explanation:

5 0
3 years ago
Why is altruism a part of pro social behavior
mojhsa [17]

Answer:

Altruism is a form of prosocial behavior, which is used to describe a person who is helping someone with no intention of having any internal or external reward in return. Some psychologists suggest that altruism is a key motivation for prosocial behavior.

8 0
2 years ago
Do all moles and scars on breast need markers for mammograms
Darya [45]
No, it doesn't. Hope that i helped :)
7 0
3 years ago
Which concepts are included in uniformitarian theory?
Margaret [11]
The party's crust must be relatively young
4 0
3 years ago
Read 2 more answers
Which types of organisms perform both
SIZIF [17.4K]
I believe it would be amoebas
6 0
3 years ago
Other questions:
  • Unlike most mites, termites can digest wood. This ability comes from protozoa that live in the a termite’s digestive tract. Thes
    5·1 answer
  • Magma that cools very slowly deep beneath the surface forms minerals with what type of crystals? a. small b. large c. very hard
    15·2 answers
  • Which of the following organelles are only found in plant cells and not in animal cells?
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which of the following statements best describes what happens when a bacterial cell is placed in a solution containing 5 percent
    14·1 answer
  • Which of the following are found in the
    6·1 answer
  • What is the process by which plant roots absorb ammonium ions and nitrate ions for use in making molecules such as dna, amino ac
    12·1 answer
  • Who was credited with the discovery of the virus?
    12·2 answers
  • Pls help...Henry is studying a family of tree frogs that have poisonous skin, and he finds one frog with a mutation for the pois
    11·2 answers
  • BRAINLIEST!! PLEASE I NEED YOUR HELP!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!