1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
13

Several bodily responses are described below. For each response, determine what caused the change in

Biology
2 answers:
EastWind [94]3 years ago
8 0

Answer:

  1. Body starts to sweat: The core body temperature exceeded the set range of 35 degrees to 41.5 degree celsius
  2. Breathing rate increases: Cells are not receiving adequate oxygen to produce adequate energy.
  3. Amount of saliva produced changes: Saliva is produced in response to pH changes in the mouth or the intake of food.
  4. Body starts to shiver: Core temperature dropped below the set range of 35 to 41.5 degree celsius.

Explanation:

Homeostasis:

Homeostasis is the physiological process of regulating the internal environment of the body against fluctuations in the external environment.

Homeostasis systems in the body follow the following basic scheme (from 1 to 4):

  1. Stimulus
  2. Sensor
  3. Control
  4. Effector

Various control centers in the body sense varying body conditions and in turn activate certain effector mechanisms to regulate the changing conditions.

Thermoregulation:

  • Thermoregulation is the control and regulation of the optimum core temperature of the body between the range 35 to 41.5 degree celsius.
  • The control center is the hypothalamus, a part of the brain that receives signals from receptors in the body and initiates the appropriate response.
  • If the core temperature exceeds the optimum range, two mechanisms are initiated:
  1. The blood vessels towards the skin and extremities dilate, increasing the blood flow, allowing heat loss to the environment.
  2. Sweat glands are activated, evaporation of sweat produces a cooling effect.
  • If the core temperature decreases, again, two mechanisms are activated:
  1. Blood vessels to the extremities constrict to prevent heat loss; those towards the core dilate to provide maximum heat to the internal organs.
  2. Shivering mechanisms (involuntary muscle contractions) are activated that generate heat.

Respiratory Homeostasis:

During exercise or strenuous physical activity, our cells need to produce a large amount of energy through cellular respiration. Since, cellular respiration requires oxygen, more and more oxygen needs to be supplied to the cells. A low oxygen signal detected by the hypothalamus (control center in the brain) increases the breathing rate to ensure that sufficient oxygen reaches the cells.

Oral homeostasis:

The salivary glands maintain the homeostasis of the oral cavity. Saliva is not produced in response to food but to maintain the pH of the oral cavity to protect the teeth and enamel. Saliva contains the enzyme amylase which digests carbohydrates in the mouth. Therefore, the production of saliva increases in response to smell, sight and taste of food.

lubasha [3.4K]3 years ago
8 0

Answer:

1.change in temperature

2.lack of oxygen

3.need for water

4. change in temperature

hope its helps

Explanation:

You might be interested in
Pls help me answer thank you
saveliy_v [14]

Answer:

b is the correct answer

Explanation:

hope it helps u..

7 0
3 years ago
Can someone help do 1-4?
Andreyy89
This is not  really clear
7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
A certain species of marine invertebrate lays its eggs in the body of a fish. The eggs develop and mature within the fish, consu
Basile [38]
Option B is the answer..
8 0
3 years ago
Read 2 more answers
For each molecule of glucose consumed, how many times does the Krebs cycle occur?
bagirrra123 [75]
For each molecule of glucose consumed, the Krebs cycle occurs: D. twice
1 glucose --> 2 pyruvate, each one entering the Krebs as acetyl-CoA
3 0
3 years ago
Read 2 more answers
Other questions:
  • Hazard mitigation is most effective when it takes place after disasters. <br> a. True <br> b. False
    15·1 answer
  • How does a good experimental conclusion differ from an inference?
    15·2 answers
  • The anatomy in the female genital system subsection starts with the vulva and progresses upward to the:
    8·1 answer
  • Which would be more likely to carry out endocytosis: a white blood cell engulfing foreign materials or a cell that excretes horm
    10·1 answer
  • List the genetic disorders found on chromosome 11. What do you know about any of those disorders?
    9·2 answers
  • Which group is least likely to be concerned about potential long-term side effects of genetically modified
    11·1 answer
  • I NEED HELP PLEASE <br><br> will mark brainliest
    6·1 answer
  • What is the function of the Nucleus?
    9·2 answers
  • Can you use mass alone to predict whether an object will sink or float? Explain.
    10·1 answer
  • Which lipoprotein carries cholesterol to the cells in your body, but can get stuck in arteries while traveling in the blood, dep
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!