1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kobotan [32]
4 years ago
5

If an animal is in the family ursidae, what also must be true about that animal?

Biology
1 answer:
Cloud [144]4 years ago
7 0
Bears are large dog<span> like </span>mammals<span> found all around the world. There are eight different </span>species<span> of bear that are found in a wide range of </span>habitats<span> in both the Northern and Southern Hemispheres, mainly the Americas, </span>Europe<span> and Asia.</span>

<span>Most bears are </span>nocturnal<span>, solitary </span>animals<span> only really congregating during the bears mating season. The mother bear will then raise her cubs until they too, are old enough to live on their own. Bears generally have an excellent sense of smell and are also fantastic at climbing trees, swimming and are able to run at speeds of up to 35 mph for short periods of time.</span>

<span>All bears are generally classified as </span>carnivores<span> but most </span>species<span> of bear today have adapted various herbivorous traits. For example, the giant panda has a </span>diet<span> that primarily comprises of bamboo. Most </span>species<span> of bear tend to hunt </span>fish<span> over land </span>animals<span>, although its not uncommon for a bear to not eat </span>fish<span> at all.</span>

<span>In Viking northern </span>Europe<span>, the locals firmly believed that by wearing a shirt made of bear skin, the wearer would adopt the powerful characteristics of the bear such as the bear's strength and courage. Legend has it that the word </span>berserk<span> is said to originate from this belief from the way the affected men adopting these bear attributes behaved, but whether this is true or not is hard to tell.</span>

<span>The Malaysian </span>sun bear<span> is the smallest of the existing bear </span>species<span>, with the average adult </span>sun bear<span> measuring around 1 meter tall. The </span>polar bear<span> is generally the biggest </span>species<span> of bear with the adults growing to over 3 meters tall. The </span>grizzly bear<span> found in North America is the only other </span>species<span> of bear where the adults can get to this </span>size<span>, but it is uncommon.
It must be true that the animal is a type of bear</span>
You might be interested in
What is the magnification of an electron microscope?
IgorC [24]

Answer:

100000

Explanation:

7 0
3 years ago
Read 2 more answers
PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU B
bogdanovich [222]
They do not have external ears like us. but they do have ear holes located directly behind their eyes. frogs ear holes are covered with thin tympanic membranes or the eardrums that protect the inner ear cavity.
6 0
3 years ago
Briefly explain why exponential growth within a population cannot last forever.
Alexxandr [17]

Answer:

It will eventually become unsustainable because of factors like food, water, space, etc.

3 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Muscle cells, which need a lot of ATP, would be expected to have a lot of _______, the organelles involved in cellular respirati
Naddik [55]
Its <span>mitochondria im sure 

</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Researchers have crossed two true-breeding lines of peas that differ in the color of their leaf tissue: dark green vs pale green
    6·1 answer
  • 11)
    13·2 answers
  • Which shoulder ligament runs from the fingerlike projection of the coracoid process (superior to the glenoid cavity) to the coll
    9·1 answer
  • An inner and an outer membrane are characteristic of which organelle?
    8·2 answers
  • What does the model suggest about a mechanism for regulating ph in an organism?
    6·1 answer
  • Which type of biomass energy can be produced from garbage heaps?
    9·2 answers
  • Identify two different habitats in a prairie ecosystem. Name one organism found in each habitat
    9·1 answer
  • Explain how flowering and non flowering plants are classified into major groups
    12·1 answer
  • Which of the following is NOT an essential nutrient?
    8·1 answer
  • What does the weak magratic field tell you about the internal structure of Venus?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!