1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
konstantin123 [22]
4 years ago
7

01.00.20

Biology
2 answers:
butalik [34]4 years ago
8 0

Answer:

If the females start to use criteria other than the color of the feathers when choosing a partner, there would be a decrease in the variations of red tones. Thus, the variation in these tones would not be an advantageous feature.

Explanation:

The variation in the red tones of these birds allows the males with the most vibrant and striking red feathers to be considered as ideal mating partners. If females use different criteria to choose a reproductive partner, the red color variability in the male's feathers would no longer be an advantageous feature for them. For this reason, this variability would gradually decrease, until it was completely eliminated from the population of these birds.

lorasvet [3.4K]4 years ago
4 0

Answer:

Hey what are the choices?

Explanation:

You might be interested in
List all four body systems that make up the excretory system and give an example of how each body system eliminates waste.
Sati [7]

Answer:

kidneys, large intestine, skin, and lungs.

Explanation:

They all excrete

4 0
3 years ago
As discussed previously, the ABO locus in humans has three alleles, where IAand IBare co-dominant and i is recessive to each. Su
Ivahew [28]

Answer:

Explanation:

using the formula p² + 2pq + 2pr + q²+ 2qr + r² = 1 where p is IA allele is 0.35 and q is IB allele is 0.15.

Thus, the expected frequency of people with type AB blood in this population will be (2pq) = 2 x 0.35 x 0.15 = 0.105

b. The expected frequency of people with type A blood will be p² + 2pr = where r is found using the formular p + q + r = 1 = 1 - (p+q) = 1 - (0.35+0.15) = 0.5

Thus, we have the expected frequency of people with type A blood to be     (0.35² + 2x0.35x0.5) = 0.4725.

c.    <u> p² + 2pr</u> + <u>2pq </u>+ <u>q² + 2qr</u> +<u> r²</u>

       AA AO      AB      BB BO     OO

         1850       180        635      2335

frequency of IA- p = (1850 + 180/2) / 5000 = 0.388

frequency of IB- q = (635 + 180/2) / 5000 = 0.145

frequency of i- r = 2335/ 5000 = 0.467.

since r² = 2335, r = √2335 = 48.32

using the formula p + q + r = 1

4 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
. <br> Define the term enzyme. Describe how enzymes influence metabolic reactions in the cell.
snow_tiger [21]

Evan is a substance produced by a living organism which acts as a chemical symbol en

Explanation:

enzyme is produce by a living organism which acts as a catalyst to bring about a specific biochemical chemistry

8 0
3 years ago
During the winter months, water on the surface of a pond will typically freeze and this ice acts as an insulator for the water b
Oduvanchick [21]
Hydrogen bonding allows the water to expand
4 0
4 years ago
Read 2 more answers
Other questions:
  • Which part of the ear is first vibrated by a sound wave?
    15·2 answers
  • What does "the first stage of photosynthesis powers the energy engine of the world
    12·1 answer
  • All of the following are volcanoes created from lava and ash except: a. Composite c. Shield b. Cindercone d. Caldera
    14·2 answers
  • This table incudes the characteristics of all major kingdoms.
    13·2 answers
  • 1. What cannot happen to energy and matter? What can happen?
    7·1 answer
  • If I Throw a bowling ball and a tennis ball from a building, describe if one would hit the ground first and why.
    12·2 answers
  • What's the connection between epigenome and nature vs nurture?
    15·1 answer
  • Describe the development of pollen grain and formation male gamete​
    9·1 answer
  • The new idea however, became herbivores were not just controlled from the bottom, but they also had to be controlled from the to
    15·1 answer
  • What are three ways a farmer could benefit from vegetative propagation?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!