Answer: bisphosphate carboxylase oxygenase
Explanation: Ribulose-1,5-bisphosphate carboxylase oxygenase is a copper-containing enzyme that is involved in the first step of carbon fixation of the Calvin cycle. It is the most abundant protein on the earth and is the central enzyme of photosynthesis.
Answer:
UV intensity predicts the skin color of indigenous populations. Stronger UV radiation is correlated with darker skin color. Data suggest that variation in human skin melanin production arose as different populations adapted biologically to different solar conditions around the world.
Explanation:
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer:
C the grasses the antelope eat
Answer:
One of the most colorful images taken of the Moon, this NASA compilation shows shades of green and brown in addition to gray. Many Moon photos are actually color images! Unfortunately, unlike the planets, the Moon's surface has no brightly colored areas. Most of its color is a mix of dark browns, grays, or black.
Is it multiple choice?
