1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
7. PLEASE HELP A LOT OF POINTS
melamori03 [73]

Answer: oxygen

Explanation:

4 0
3 years ago
When caring for older patients, the nurse should watch for signs of dehydration due to decreased fluid intake. which factors con
stepladder [879]

The factors that contribute to the dehydration in older patients are the following;

-          Decrease in the thirst mechanism

-          The inability of holding a glass or a cup

-          Presence of confusion as well as disorientation

These are the factors in which could be seen in identifying a dehydrated individual

5 0
3 years ago
A blank is a group of tissues that work together to perform a common function
sweet-ann [11.9K]
When a group of tissues work together to perform a particular role in the human body, they make up an organ.
8 0
3 years ago
____________________ have beautiful glass-like shells.
dem82 [27]

Answer:

Glass FrogsGlasswing ButterflyBarreleyeGlass OctopusCrocodile IcefishTortoise Shell BeetleSalpsTransparent Sea CucumberGlass SquidJellyfish

Explanation:

6 0
1 year ago
20 points !<br> 5 thoughts of artificial intelligence or Non intelligence
Fiesta28 [93]
1) self awareness
2) theory of mind
3)limited memory Al
4)Reactive Al
4 0
2 years ago
Other questions:
  • A body of cell that is undergoing abnomal cell division is mostly
    8·1 answer
  • Of the three lipid types phospholipids are more similar to fats true or false
    5·2 answers
  • How do you keep your plant alive in the winter and indoors? worth 15 points
    7·2 answers
  • Study the diagram of the geological time scale. Which method is most likely used to identify what happened before the start of P
    7·2 answers
  • the distance between jupiter and the sun is 5.2 au whats the diffrence in millions of kilometers? one au is about 150 million ki
    14·2 answers
  • A student hypothesized that EC growth might be affected by the DNA from circulating erythrocytes. Is this student’s hypothesis r
    7·1 answer
  • The cell cycle has a regular system of checks and balances that prevents damaged or mutated cells from proceeding to the next ph
    10·1 answer
  • Lesson 11 part 1 introduction analyzing text structures
    8·2 answers
  • Why don't epidermal ridges form in thin skin?
    8·1 answer
  • How many different types of trees are there?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!