1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
After Meiosis 2, how many chromosomes will I have in each cell if I start with 48 chromosomes in my original parent cell? Is the
Sophie [7]

Answer:

you would have 24 chromosomes  and it would be haploid

Explanation:

5 0
3 years ago
Explain how the bacteria and animals around the hydrothermal vents showed scientists that life was much more adaptable than they
lisov135 [29]

Explanation:  

Well, its extremely hot in the hydrothermal vents. Scientists simply believed it would be impossible for anything to survive due to the heat. Bacteria and micro-organisms were able to adapt to growing there, though. So in short words, they survived extreme conditions teaching scientists that life was quite adaptable.

Weird fun fact: In Switzerland it is illegal to own just one guinea pig. Felt the need to mention that ^ Sorry, I know it has nothing to do with the question but i felt it was worth speaking of.

6 0
3 years ago
_____ cells are commonly dispersed (mixed in) with simple columnar epithelial cells. They are responsible for secreting mucus.
WINSTONCH [101]

Answer:

"Macrophages" cells are commonly dispersed (mixed in) with simple columnar epithelial cells. They are responsible for secreting mucus.

Explanation:

8 0
3 years ago
Which of the following is an anion
Oxana [17]
What are the choices?
3 0
3 years ago
Can you please help me with this question?
Diano4ka-milaya [45]

Answer:

B

Explanation:

Plz mark brainliest ;)

5 0
2 years ago
Read 2 more answers
Other questions:
  • Help me ??? which of the following statement is true regarding the process of photosynthesis?
    14·2 answers
  • What are the two layers of the skin which layer contains keratinied cells?
    15·1 answer
  • A scientist is studying the metabolic processes carried out by a certain bacterium. Which of the following observations would in
    8·1 answer
  • Use the drop-down menus to determine which type of white blood cell is described below.
    15·1 answer
  • Which best describes the volume of a liquid?
    8·1 answer
  • Where is the squid shell found and what is it called
    12·1 answer
  • How many fundamental forces exist in nature?<br> two<br> three<br> four<br> five
    6·2 answers
  • Why are there more people with sickle cell disease in one part of the world than in other parts?
    12·1 answer
  • Select the correct answer from each drop-down menu.
    15·1 answer
  • According to newtons laws of motion, what causes an object to change its state of motion
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!