1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
Explain how the structure of an enzyme relates to how well the function catalyzes chemical reactions
maxonik [38]
<span>The site active of the enzyme bins the substrate to form the complex enzyme-substrate to start a specific chemical reaction. The site active of the enzyme has to fit exactly the shape of the substrate to trigger the catalysis.</span>
6 0
3 years ago
The protostome developmental sequence arose just once in evolutionary history, resulting in two main subgroups—Lophotrochozoa an
Lelechka [254]

Answer:

<h2>c. Division of these two groups occurred after the protostome developmental sequence appeared. </h2>

Explanation:

  • Protosomes are such types of organisms in which the mouth part developed first during embryonic development.
  • Those animals in which anus develop first are known as deuterostomes.
  •  This differentiation takes place during the embryonic development of the organisms.
  • Since lophotrochozoan and Ecdysozoa both are protostomes animals and categorized on the basis of molecular evidence.
  • Thus these two groups were formed after the appearance of the protostomes.

8 0
3 years ago
True or false sedimentary rock can form for metamorphic rock that has been uplifted
Hitman42 [59]
False
Sedimetary rocks can be formed from changes in igneous rock, and igneous rock can be from changes in sedimentary rock.
4 0
3 years ago
Biology
Yakvenalex [24]

Answer:

a .carbon dioxide(Co2) and water (H2O)

b. air and soil

Explanation:

During photosynthesis, plants take in carbon dioxide (CO2) and water (H2O) from the air and soil. Within the plant cell, the water is oxidized, meaning it loses electrons, while the carbon dioxide is reduced, meaning it gains electrons. This transforms the water into oxygen and the carbon dioxide into glucose.

4 0
2 years ago
How do air masses that form over the land and ocean Affect weather in the United States?
olga nikolaevna [1]

Answer:

b

Explanation:

hope this helps

4 0
3 years ago
Other questions:
  • Both the consumption of alcohol and the ingestion of antianxiety drugs work to increase the activity of __________, which is an
    11·1 answer
  • Answers are
    8·1 answer
  • There are _____ phyla or categories of fish. 2 3 4 5
    8·1 answer
  • Question 5 (1 point)
    13·1 answer
  • Which of the only four available pints of blood (A+, AB–, B–, and O+) should the patient receive for a transfusion?
    12·2 answers
  • Explain how the law of dominance is related to meiosis.
    5·1 answer
  • Which is a characteristic of fast-twitch muscle fibers?
    5·1 answer
  • Please please help...what will happen to these glands if they strike?​
    12·1 answer
  • Which of the following best explains what happens to the water that is expelled by photosynthesis?
    6·2 answers
  • A person who has type AB blood:
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!