1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
What is the most appropiate unit of measurement fro most types of cells?
Rzqust [24]

Solution:

The most appropiate unit of measurement fro most types of cells is CD4 counts are measured in cells per cubic millimetre = cells/mm3. A cubic millimetre (mm3) = mm3 = 1 mm x 1 mm x 1 mm.

This is the required answer.

6 0
3 years ago
Which two organ systems regulate homeostasis in our bodies?
Usimov [2.4K]
The correct answer for the given question above would be option A. The two organ systems that regulate homeostasis in our bodies are nervous and endocrine. The nervous system is responsible in the coordination of different systems in the body, including the voluntary and involuntary function. Whereas, the endocrine system, along with the nervous system is responsible for the regulation of different hormones that are responsible for different functions in the body.
6 0
3 years ago
List four different primary energy resources that humans have used.
Butoxors [25]

Answer:

हिंदी में खोजें

मानव द्वारा उपयोग किए जाने वाले चार विभिन्न प्राथमिक ऊर्जा संसाधनों की सूची बनाएं

<em><u>Crude oil, coal, wind and natural gas are all primary energy sources. Electricity is not a primary energy source, it's an energy currency (see electricity as an energy currency for an in depth discussion). Likewise, secondary fuels are also energy currencies and aren't primary energy sources, they must be made.</u></em>

4 0
3 years ago
Read 2 more answers
Im confused on the last two... please help...thanks as well
Marina CMI [18]

Answer:

whats the question???????????? and the answers???????????????????

Explanation:

6 0
2 years ago
Which types of organisms are always made up of only one cell each?
koban [17]

A unicellular or single celled organism is the term for organisms composed of only one cell.

I hope this helped!

6 0
3 years ago
Read 2 more answers
Other questions:
  • Wich taxonomy level for a given genus includes the greatest number of species
    11·1 answer
  • What are the major components of plasma membranes?
    10·1 answer
  • A good question to use for a scientific investigation should be testable, and it should be connected to science concepts. Casey
    8·2 answers
  • Respiration releases ____.
    8·1 answer
  • Pores in the leaf that allow air to enter the leaf are called
    13·2 answers
  • 24. Heat is not typically used after an injury until how many hours have passed?
    7·2 answers
  • Which feature do prokaryotic and eukaryotic cells share?
    7·2 answers
  • Which is a characteristic of fast-twitch muscle fibers?
    5·1 answer
  • What kind of plants do people usually put on display for Christmas?
    14·2 answers
  • Faris and his wife have normal skin color, but they both have a parent with albinism if
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!