1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
P waves and S waves are alike in that they ___
Grace [21]

They are both types of seismic waves produced by the sharp movement of rock within the earth.

5 0
3 years ago
Una parte de la radiación
diamong [38]

La troposfera es la capa de la atmósfera donde una parte de la radiación infrarroja es absorbida por los gases de efecto invernadero.

En la capa de la troposfera, que es la capa más baja de la atmósfera, hay vapor de agua, dióxido de carbono, metano y algunos otros gases que son responsables de la absorción de la radiación infrarroja. Parte de la radiación infrarroja se escapa al espacio, pero una parte es detenida y absorbida por los gases de efecto invernadero presentes en la atmósfera.

Esta absorción de radiación infrarroja por los gases de efecto invernadero contribuye a un aumento de la temperatura de la superficie de la tierra y de la atmósfera. Entonces, podemos concluir que la troposfera es la capa de la atmósfera donde una parte de la radiación infrarroja es absorbida por los gases de efecto invernadero.

Learn more: brainly.com/question/25552770

4 0
2 years ago
What might happen within an ecosystem if the snake population runs out of small animals to eat such as mice or rabbits?
ozzi
If the snake population runs out of small animals to eat such as mice or rabbits then the snakes would starve and die unless they could move to another habitat. All of the other animals in the food web would also die due to their lack of food supplies. The populations of the consumers would fall as the population of the producer fell.

HOPE THIS HELPS! :)
8 0
2 years ago
Translation occurs in which part of the cell?
Elza [17]

Explanation:

Where Translation Occurs. Within all cells, the translation machinery resides within a specialized organelle called the ribosome. In eukaryotes, mature mRNA molecules must leave the nucleus and travel to the cytoplasm, where the ribosomes are located.

4 0
2 years ago
A scientist discovers a DNA-based test for one allele of a particular gene. This and only this allele, if homozygous, produces a
Marina86 [1]

Answer:

b. Design a test for identifying heterozygous carriers of the allele.

3 0
3 years ago
Read 2 more answers
Other questions:
  • You are in the lab and notice another student applying cosmetics, why is this dangerous and not allowed in a lab? Cosmetics can
    13·2 answers
  • An animal cell lacking carbohydrates on the external surface of its plasma membrane would likely be impaired in which function?
    13·1 answer
  • In experiments testing the cocktail party effect, most participants were unable to do any of the following except _____________.
    9·2 answers
  • Where can most of the fresh water on the earth be found
    8·2 answers
  • Describe three types of relationships between organisms found within an ecosystem. How is energy transferred in each type of rel
    15·1 answer
  • Maple tress and tulips are classified as autotrophs because they both
    6·1 answer
  • Real life example of scientist investigation using observation, hypothesis, and prediction
    15·2 answers
  • Define transpiration
    7·1 answer
  • Explain why scientirsts concluded that the instructions for species characteristics were carried in DNA.
    15·1 answer
  • Producers, such as those that make the foods that are shown below, make glucose during the process of photosynthesis. Where in t
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!