1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
Which attributes would allow a cell to be larger?
Leno4ka [110]

Answer:

Perfectly cube - shaped

Explanation:

If the shape of a cell is perfectly cube- shape then its volume must be calculated with an equation:

Height×Width×number of sides and number of boxes

Surface= area of volume ratio is calculated with an equation

Area /volume

if a cell has large surface area to volume into ratio means it has greater exposure to the environment.It means that flow of nutrients and gases move freely in the small cell compared to large cell.

4 0
3 years ago
Read 2 more answers
What are the characteristics of carbon bonds?
Fofino [41]

Answer:

Carbon's characteristics include its ability to bond with oxygen, hydrogen, nitrogen, phosphorus and sulfur.

Explanation:

Carbon biochemical compounds are essential to all life on the planet. Because of its bonding ability, carbon can form single, double, or triple covalent bonds with other atoms.

7 0
3 years ago
What traits would help a predator be more “fit” to survive in each environment?
Murrr4er [49]
White snowy place- color of the animals fur. For example white to blend in with the snow

6 0
2 years ago
Under conditions of darkness, a euglena acts more like a(n) _______. A. animal B. plant C. human D. fungus
icang [17]
B PLANT<span> maximize its </span>photosynthesis
3 0
2 years ago
Read 2 more answers
There are different types of nerves or mechanoreceptors located in your skin. Nerves that detect deep pressure are called _____.
balandron [24]
Pacinian corpuscles are rapidly-adapting, deep receptors that respond to deep pressure and high-frequency vibration.
8 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following methods might be used to decrease the rate of approach to carrying capacity by the developed world?
    12·1 answer
  • Dna is a polymer, which means that is made up of many repeating single units (monomers). what are the monomers called?
    9·1 answer
  • What is inside every cell in our body
    8·2 answers
  • The endocrine gland that is often called the "master gland" because it affects the output of the other endocrine glands is the _
    12·1 answer
  • Is the cell membrane of a cell with high mass or the cell membrane of a cell with low mass better able to feed the cytoplasm of
    14·1 answer
  • People with enlarged thyroid glands develop a condition called "goiter." this is often visible as:
    14·1 answer
  • Which of the following is Not noted when samples of insects are taken?
    9·1 answer
  • Which is NOT true about
    8·1 answer
  • Limited resources on the galapagos islands result in?
    12·1 answer
  • Mia has four aquatic plants of same size and species.She submerges each plant in a separate filled with 200 ml of water. She the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!