1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
Similar cells that are grouped together and perform a common function are called
kramer
Tissue such as muscle. 
4 0
3 years ago
Which of the following moves using pseudopods ?
marissa [1.9K]

Answer:

B

Explanation:

3 0
3 years ago
Read 2 more answers
What rare disease suddenly became much more common in the 1950s? according to the video, what rare disease suddenly became much
Sergeu [11.5K]
The answer to this question would be: <span>lung cancer

In 1950, the medical practitioner doesn't know the relation of cigarette smoking with lung cancer. In that era smoking advertising is very massive and some physician even helps it. This cause increased amount of lung cancer incidence. The amount of lung cancer continues to increase till 1980-1990</span>
3 0
3 years ago
what is energy coupling? 1. the hydrolysis of atp to adp p 2. the use of energy released from an exergonic process to drive an e
Helen [10]
When two energy mechanisms compound
4 0
3 years ago
1. Describe the differences between radiation, conduction, and convection.
kkurt [141]

1. Radiation - energy transmits through particles that ionize. Conduction - heat is transferred through a substance without moving the material. Convection - transfer of heat through movement.

2. Earth receives energy from the sun, which is transferred between Earth and its atmosphere.

3.<span>Wildland fires, dust storms, and volcanic activity. They release CO2, CH4, N20, and sulfur dioxide.</span>

4. Burning coal, releases carbon dioxide and other pollutants. Gasoline, releases air pollution. Factories, releases carbon dioxide, methane, and nitrous oxide.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Wat is the smallest unit that carry on all function of life
    13·2 answers
  • Is the length of shadows at noon higher in summer or winter?
    12·2 answers
  • Which of these genes are located on the q arm of chromosome 17?
    9·1 answer
  • How has using the water in Flint affected the local population?
    10·1 answer
  • A researcher is setting up an experiment to compare the rates of movement of individuals from different light-sensitive single-c
    10·1 answer
  • The taking of a sediment to a new location is called?
    15·2 answers
  • Select all that apply. Select the true statements about Eubacteria. Most live as decomposers and heterotrophs. Most only thrive
    14·1 answer
  • What does the mitochondria do?
    8·1 answer
  • Hemophilia is caused by _____.
    12·2 answers
  • why do cold-blooded animals, such as snakes and turtles, need to bask in sunshine before they can move as quickly as warm-bloode
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!