1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
True or false Evaporation is an example of a chemical change
dmitriy555 [2]
False. Evaporation is a physical change it is not a chemical change. It is a physical change because it is going from the liquid phase to the gas phase. It is not a chemical change because it is still made of two hydrogen atoms and an oxygen atom.
5 0
3 years ago
Read 2 more answers
Giving brainly
Vaselesa [24]
Correct answer is ... Seeds have endosperm which provides nourishment for a new plant, but spores do not have any stored food supplies. :)
5 0
3 years ago
The process of genetic engineering may include either four or five steps. The diagram represents the five-step process. mc010-1.
Lyrx [107]
The answer is "B", recombinant DNA.
7 0
3 years ago
Anaerobic respiration occurs when ____.
Juli2301 [7.4K]
When oxygen is absent, anaerobic respiration occurs ('an' means without).
6 0
3 years ago
Read 2 more answers
Which monomer makes up a polypeptide?
Misha Larkins [42]
Building a polypeptide: Polymers are chains of subunits, monomers, linked together by chemical bonds. The bond between two amino acids is known as a peptide bond<span>. Two amino acids, joined together by a </span>peptide bond<span>, are known as a </span>dipeptide<span>. An amino acid polymer is known as a polypeptide.</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • The species or which of these groups show neither wings nor antennae?
    13·1 answer
  • Hormone molecule performes its function
    5·2 answers
  • What does the Diagram of the water intake by a Bryophyte look like?
    8·1 answer
  • Interpreting Date: Bob straps on his
    5·1 answer
  • Will mark brainlest​
    15·2 answers
  • Consider the diagram that depicts the lysogenic and lytic cycles.
    9·1 answer
  • This problem has been solved!See the answerIn sheep, coat color is influenced by two genes. Gene A influences pigment production
    5·1 answer
  • Which does the shift of the hydrogen absorption spectrum of a galaxy provide evidence for? Select the three correct answers.
    11·1 answer
  • Peanut plants have 40 chromosomes. How many CHROMATIDS will there be when meiosis begins? *
    7·1 answer
  • Choose the correct combination to link each part to its function
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!