1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
European rabbits were introduced into Australia and quickly spread, reproduced, and became a terrible pest. They eat up to $600
Alina [70]

Answer:

True. This is the case where an invasive species has reduced the genetic diversity of indigenous species.

Explanation:

  • An invasive species is an exotic, foreign species that takes over a specific habitat or ecosystem and destabilizes it.
  • Invasive species disrupt the food chains of an ecosystem which may lead to increase in populations of some species while reducing others.
  • Invasive species compete with indigenous species for food, shelter and mates. As the indigenous species cannot reproduce properly, a reduction in their genetic diversity is the direct result.
3 0
3 years ago
All cells have which of the following structures?​
Marta_Voda [28]

Answer: organelles

Explanation:

5 0
3 years ago
Read 2 more answers
what can cause a decrease in soil quality of farm land that is left without crops during some months every year
mixer [17]

Answer:

Let the land lie fallow for a season

Explanation:

In Agriculture when a farmer has some problems with the quality of his soil due to continued planting all year round without allowing the soil rest, there seems to be loss of some of the nutrients that help crops grow and he is unable to grow crops on his field.

The best option is to allow the land low fallow with grasses and other plants growing and replenishing the soil.

3 0
3 years ago
The Krebs cycle is considered a cycle because?
AlekseyPX
<span>The citric acid formed remains in the mitochondria for the next acetyl CoA</span>
5 0
4 years ago
A geothermal plant has been built in a location. Which of these is the most likely impact of the plant on the location?
Jlenok [28]
Geothermal plants rely in energy from hot springs to produce electricity so the correct answer is B.
6 0
3 years ago
Read 2 more answers
Other questions:
  • A wave with high amplitude _____.
    8·2 answers
  • Photosynthesis. We know several things about this process. First, it is driven by light, usually sunlight. It is preformed by au
    8·2 answers
  • Differentiate between hazards and risk.
    14·1 answer
  • What is not a step in the scientific method
    5·1 answer
  • The principle of __ suggests that a gene pair separates during gamete formation.
    13·2 answers
  • Please help! I don’t understand , I will mark branliest if you help
    6·1 answer
  • Fernando is looking at a cell under a microscope, and he thinks it is a plant cell. Which of the following questions could he as
    15·1 answer
  • So, if this is one strand of DNA, what will the other strand look like?<br> A T G C C G A T A
    13·1 answer
  • 1. Define communicable diseases. Give three examples.
    11·1 answer
  • If you were running an experiment to determine the temperature at which beans sprout the fastest, what would be the variable?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!