1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
If this one person planted 40 millions trees, what can you do to make at least a minimum impact to reduce humankind's impact on
lukranit [14]

Answer:

recycle, use less nonrenewable resources, dont do pollution, dont litter. Take care of our Earth <3 there is no backup planet..

Explanation:

5 0
3 years ago
During dna replication
11111nata11111 [884]
During DNA replication, <span>the template strands must separate so that both can be copied.</span>
6 0
3 years ago
Predict how changing the grass population will affect the other organisms at first. Write + for “Increase” or – “Decrease” next
Afina-wow [57]

Answer: Here you go!

Explanation:

Doubling the amount of grass would definitely increase the rabbit population since there is more food/resources for it to produce. Since the food chain has a domino effect everything else would go up as well because of the increase of food/resources that will help sustain the population of all. so for the first line it would be increase for rabbit snake and hawk. Halving the amount of grass would effect the population of all animals as well. But in a more negative way. It would decrease because the rabbits wouldn't have enough food to produce and thrive. With the decline of rabbits less snakes will live because of the low amount of their main food source. Same with the eagles. So therefore it would be decrease in all the bottom lines.

5 0
3 years ago
The physical appearance physical appearance of trait is called the of trait is called the
ANEK [815]
The physical appearance of a trait is called the phenotype of an organism.
8 0
3 years ago
Read 2 more answers
PLEASE JUST ANSWER DO NOT ATTACH IMAGE
anzhelika [568]

Answer:

D

Explanation:

Im not exactly for sure on this one, but if i were you, i would choose either A or D . Homeostasis is like the normal for something when they it isnt sick. Its when they are doing good with not really any concerns!

4 0
3 years ago
Read 2 more answers
Other questions:
  • We need lots of energy to do the things we want to do: keep our houses warm, drive cars, run computers, grow and harvest food. T
    15·1 answer
  • Which conclusion can be made from the data in the table? The higher the temperature, the fewer chirps there will be in 10 second
    5·2 answers
  • Evolution by ___ ____ is the theory that maintains that population inherited traits change over time
    10·1 answer
  • Which three types of cells are<br> found in the stratum basale?
    12·1 answer
  • The textbook the quantum efficiency for photosynthesis decreases abruptly when the wavelength of light being used becomes longer
    8·1 answer
  • What type of cells are produced during meiosis?
    12·2 answers
  • Competition for resources is a limiting factor because​
    12·1 answer
  • Ashton is a crime scene investigator. He ensures that all the evidence gathered at the scene is properly handled and labeled. Wh
    14·1 answer
  • Which of the following should replace the question mark in this diagram​
    15·1 answer
  • What evidence suggests that proteins are synthesized and modified in the rough er as opposed to the smooth er?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!