1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
12

What is the mRNA that would be transcribed from this strand of DNA?

Biology
1 answer:
Illusion [34]2 years ago
8 0

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

You might be interested in
What are two things that can be done to maximize the chances of recovering parasites from a fecal smear?
RideAnS [48]
<span>Sedimentation - uses solutions of lower specific gravity than the organisms, which concentrated in the sediment. This technique is recommended for general diagnostic laboratories because it is easy to perform and less prone to technical errors.

Flotation - this technique uses solutions of higher specific gravity than the parasitic organisms so the organisms float and the debris sinks producing a cleaner material while the disadvantage is that walls of cysts and eggs collapse that may blocking its identification.<span>
</span></span>
7 0
3 years ago
Which of the following events normally activates a GTP-binding protein?a).GTP hydrolysis by the protein Activation of an upstrea
olya-2409 [2.1K]
<h3><u>Answer;</u></h3>

b). Activation of an upstream guanine nucleotide exchange factor

<h3><u>Explanation</u>;</h3>
  • <em><u>When a ligand activates the G protein-coupled receptor, it induces a conformational change in the receptor that allows the receptor to function as a guanine nucleotide exchange factor (GEF) that exchanges GDP for GTPthus turning the G protein-coupled receptor on.</u></em>
  • The activated G-protein then dissociates into an alpha (G-alpha) and a beta-gamma complex.
8 0
3 years ago
5. The first protein produced by
klio [65]

Answer:

Ribosomes of the cell

6 0
3 years ago
What finding should prompt further diagnostic testing in a child presenting with diarrhea? a. Blood and mucus in the stools b. G
DIA [1.3K]

Answer: a. Blood and mucus in the stools.

Explanation:

Diarrhea is a gastrointestinal problem. It is associated with the symptoms of loose stools, cramps, vomiting, fatigue, and stomach pain. The diarrhea usually last for few days to week. It is also associated with the signs of dehydration due to loss of fluid through loose stools like stretchiness in skin, loss of color of skin, and fast heart rate. The diagnostics of diarrhea can be done by examining the blood and mucus in the stool.  

7 0
2 years ago
PLEASE HELP
Aleksandr [31]

Answer:

Education after high school. A bachelor's degree in agricultural science is required for jobs in research. ...

Work Experience. Previous work experience in a particular research area may be required for some jobs.

On-the-job training.

Explanation:

Have a great day!

7 0
2 years ago
Other questions:
  • What process is described here? A concentration gradient of H + ions is created in the periplasmic space by actively transportin
    5·1 answer
  • What might happen if you were hit hard on the side of the head-- towards the middle
    6·2 answers
  • I have some blue flowers and some green flowers of the same species. i planted the seeds after cross pollinating them. wow! i go
    15·1 answer
  • WHat is the difference between carbohydrates and protiens and lipids?
    6·1 answer
  • Which condition would result in the lowest alveolar ventilation rate?
    5·1 answer
  • What is one way that fission and fusion are similar?
    11·2 answers
  • You have a 12 sided cube that is numbered from 1 to 12. What is the probability of rolling a five?
    8·2 answers
  • What is the relationship between the leach and plover
    15·1 answer
  • Hey guys could you help me???
    7·1 answer
  • Oligo polysacchoride importance in blood transfusion and tissue organt transplant
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!