1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
4 years ago
15

1 Point

Biology
2 answers:
xz_007 [3.2K]4 years ago
8 0

Animals get the Nitrogen they need by D. Eating Plants.

Dima020 [189]4 years ago
4 0

Answer: D

Explanation:

plants get nitrogen from the soil or water and then animals get nitrogen from the plants when they eat them.

You might be interested in
Describe the importance of minerals
Mashutka [201]
Just like vitamins, minerals help your body grow, develop, and stay healthy. The body uses minerals to perform many different functions — from building strong bones to transmitting nerve impulses. Some minerals are even used to make hormones or maintain a normal heartbeat. Hope this helps:)
6 0
3 years ago
If the circulatory system failed what would happen to the heart rate?
Gelneren [198K]
The heart rate would decrease because there is less oxygen being supplied to the cells for cellular respiration, and also your muscles won't get the blood it needs. Blood also contains oxygen and glucose which cells need to convert food to energy and to survive, so if the cells don't get blood they will die which will eventually kill the organism
8 0
4 years ago
Read 2 more answers
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
How do babies absorb in the womb absorb glucose
Eva8 [605]
By the mother digesting it
4 0
3 years ago
Which of the following can be found in all types of cells?
Illusion [34]

Answer:

Explanation:

All cells have  CTYTOPLASM AND DNA.Hope this helps

3 0
3 years ago
Other questions:
  • Which of these best describes genetic drift?
    11·2 answers
  • April wants to add _____ to her salad, because the food is a naturally rich source of omega-3 fats.
    14·1 answer
  • The minimal circumstances under which medical attention should be sought for a burn victim is when the surface area of a second
    11·1 answer
  • A sudden change in chromosomes or gene?​
    9·2 answers
  • Which of the following are components of the nonspecific immune response?
    12·2 answers
  • Which small piece of a DNA molecule contains no base pairing errors?
    6·2 answers
  • Which of the following best describes the function of the spinal cord?
    9·2 answers
  • Which sentence best summarizes Darwin’s theory of evolution by means of natural selection?
    14·1 answer
  • How many kingdoms are there in the domain Bacteria? <br> A. 4 B. 3 C. 1 D. 2
    9·2 answers
  • Which example is a biotic factor of an aquarium environment?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!