1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
8

Flowering plants are the most successful land plants. This is due, in part, to the trait that could be the label for point

Biology
2 answers:
Oksanka [162]3 years ago
6 0
<span> Flowering plants are the most successful land plants. This is due, in part, to the trait that could be the label for point C. in the cladogram. What trait is unique to this group of plants?It's C.seeds protected in fruits </span>
Nookie1986 [14]3 years ago
3 0

Answer: c.seeds protected in fruits        

All flowering plants belong to the group of angiosperms. These plants exhibit true roots, stems and leaves. The ovary in these plants are enclosed in a flower and the fertilized ovules develop into seeds which are covered and preserved inside a fruit develop from other parts of the flower. This trait is unique in the group of flowering plants.

You might be interested in
PLZ HELP I'M NOT TRYING TO GO TO SUMMER SCHOOL I WILL BRAINLIST YOU
Neko [114]
1. Three (3) Phylums
2. Nine (9) Classes
3. The Class has more groups.
4. The Phyla contains more organisms.
7 0
3 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Given the following DNA sequence, what would be the corresponding mRNA sequence?
Andrei [34K]
Huh What’s the answer
8 0
3 years ago
Read 2 more answers
A researcher who describes illness solely in terms of biological causes and factors is using a(n)
erica [24]

Answer:

The correct answer is "biomedical model"

Explanation:

The biomedical model is an approach that looks to understand the biological functions under normal and abnormal circumstances. A researcher who describes illness solely in terms of biological causes and factors is using a biomedical model. This model is a scientific approach to fight diseases which is very helpful for the development of new therapies, however it could result in confusion particularly if it is used to explain the disease to a patient.

5 0
4 years ago
What type of resource is Sunlight?
erastova [34]
C. Non renewable only
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which action in the biology laboratory would be most likely to result in an accident?
    9·2 answers
  • Select the correct answer from each drop-down menu.
    8·1 answer
  • What 3 parts of a plant cell work together to create needed materials like glucose
    12·1 answer
  • The information above shows that silicon has both beneficial and detrimental effects on the human body. Given this information,
    5·1 answer
  • Blank are where genes are found
    8·2 answers
  • Which state of matter is made up of particles with the greatest amount of
    11·1 answer
  • Is a major product made from gymnosperms
    7·1 answer
  • Did any mixtures form? Why or why not?
    13·2 answers
  • 7. Where are temperate grasslands found?
    5·1 answer
  • True or False. Meiosis produces 4 haploid cells so they can undergo fertilization to become diploid?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!