1. Three (3) Phylums
2. Nine (9) Classes
3. The Class has more groups.
4. The Phyla contains more organisms.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer:
The correct answer is "biomedical model"
Explanation:
The biomedical model is an approach that looks to understand the biological functions under normal and abnormal circumstances. A researcher who describes illness solely in terms of biological causes and factors is using a biomedical model. This model is a scientific approach to fight diseases which is very helpful for the development of new therapies, however it could result in confusion particularly if it is used to explain the disease to a patient.