1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fantom [35]
3 years ago
5

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster

than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from
Biology
1 answer:
Mariulka [41]3 years ago
7 0

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
2 years ago
Many land plants store energy in starch. When energy is needed, the starch molecules can be broken down quickly. Starch is which
puteri [66]

Answer:

C6H10O5

Explanation:

6 0
2 years ago
If you ate more food from secondary consumers, how would this change the percentage of the biomass pyramid necessary to support
Anna007 [38]

Answer:

would increase

Explanation:

The pyramid of biomass is a diagram that exhibits the total biomass of the organisms at different trophic levels, which are required to support life in a given ecosystem. This pyramid usually starts with producers situated on the bottom (e.g., plants), then continues with the organisms that eat these primary consumers (herbivores), after with secondary consumers (carnivores), and so successively. The pyramid of biomass indicates the amount of mass of 1-primary producers required to support the life of the primary consumers, 2- primary consumers needed to support the life of the secondary consumers, 3-secondary consumers needed to support the life of the tertiary consumers, and so successively for each trophic level. In this diagram, the trophic level with a higher amount of biomass (and energy) is usually represented by the producers (i.e., by organisms on the bottom), and this amount of biomass decreases as long as more levels are considered. In consequence, if more food from secondary consumers is consumed, it will produce an increase in the percentage of biomass that is needed to support life.

5 0
3 years ago
The community level of ecological organization include all other levels true or false
Charra [1.4K]
<h2>its true</h2><h2>the ecological system of organization is a gigantic scale of all sorts of sh*tt</h2>
3 0
3 years ago
Which of the following statements is true? Water is not a limiting factor in an aquatic ecosystem. An ecosystem can carry an unl
Nutka1998 [239]

the last one.


hope this helps

6 0
3 years ago
Read 2 more answers
Other questions:
  • Explain how a dog meets all of the characteristics of life. You may conduct your own online research using credible websites to
    13·2 answers
  • What is genetic drift
    8·2 answers
  • Most of the oil that polluts the ocean comes from
    14·1 answer
  • What general type of microscope uses bright illumination and multiple glass lenses?
    7·2 answers
  • The native range of a species includes all areas in ahich it lives
    10·2 answers
  • In a population, when the birthrate becomes higher than the death rate, the population's growth rate A) decreases. B) increases.
    13·2 answers
  • During photosynthesis, plant leaves take in carbon dioxide through what in their leaves?
    6·1 answer
  • Emily is developing a computer model of protist populations in certain areas of the ocean, and how they help maintain homeostasi
    9·1 answer
  • Which of the following is not part of the inflammatory response?
    7·1 answer
  • Which outcome is the main function of the light dependent reaction‘s of photosynthesis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!