1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad [161]
3 years ago
8

At what angle relative to the velocity of a red blood cell should the transducer be held during Doppler ultrasound to most accur

ately determine blood velocity?
Biology
1 answer:
Charra [1.4K]3 years ago
3 0

Answer:

The answer is 0º

Explanation:

The options are;

A. 0º

B. 30º

C. 45°

D. 90°

The answer is A- 0º (Zero degree)

Cosine θ is applied as a correction for the angle between the ultrasound beam and the direction of blood flow. Cos θ = 1 if the beam is parallel to the direction of blood flow, which allows the Doppler ultrasound measure maximum and accurate velocity.

You might be interested in
Compare and contrast the infection of a bacterial cell by a lytic bacteriophage with the infection of an animal cell by a retrov
NARA [144]
Yes, Some Have The Same Body Cells Some Have Different Body Cells.
3 0
3 years ago
Which of the following levels is the least inclusive, smallest, and most specific of the choices? A. Kingdom B. Order C. Family
Solnce55 [7]
<span>The correct answer is C. Family. That is because the only things smaller than family are genus and species and they are not mentioned here. Life and domain are larger than kingdom and kingdom is larger than phylum. Class and order are smaller than phylum but are larger than family. That's why your correct answer is family.</span>
7 0
3 years ago
What is the loss of water by plants called?
ANEK [815]

Answer: the answer is A:Transpiration

Explanation:

I know everything

3 0
3 years ago
What is the answer for this question please help
Nezavi [6.7K]
The plant belongs to the group Angiosperm. Vascular plants with seeds could be cycads, Gingko, conifers, or angiosperms. Among those groups, only angiosperms have flowers.
The plant they found have colored, scented flowers which suggests that it could be pollinated by insects or birds. Colored flowers attract birds and insects. Color serves as a guiding mark. Talking of scent, it does not attract bird, but attracts insects. It also serves as the guiding mark.
7 0
3 years ago
What is the height and length of a arctic tern?
Sonbull [250]

Answer:

The Arctic tern is a medium-sized bird around 33–36 cm (13–14 in) from the tip of its beak to the tip of its tail. The wingspan is 76–85 cm (30–33 in). The weight is 86–127 g (3.0–4.5 oz.).

Explanation:

6 0
2 years ago
Other questions:
  • Why does a year consist of 365 days and a day of 24 hours?
    15·1 answer
  • What percentage of energy is transferred when a mouse is eaten by a fox? 90% 0% 10% 100%
    14·1 answer
  • Samantha's doctor is concerned that samantha may have a brain tumor. which method of neuroimaging should he use to detect the tu
    7·1 answer
  • How is volume, temperature, pressure and density of gas related
    9·1 answer
  • Lightning strikes a tree and stars a forest fire. This is an example of the affecting the .
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The image on the screen is a picture of a hydrated
    13·1 answer
  • PLEASE ANSWER!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    15·2 answers
  • Light energy is converted into this type of energy usable by all organisms
    6·1 answer
  • If water is at 26 degrees c and has a salinity of ____, its density is 1.023 g/cm3
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!