1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
3 years ago
10

Do cells come in different shapes and sizes ?

Biology
2 answers:
jekas [21]3 years ago
4 0

Answer:

Yes, cells come in all shapes and sizes.

Explanation:

Cells are of different shape,size and structure according to the function they needs to perform,  each cells do different things.

Aloiza [94]3 years ago
3 0

Answer:

yes

Explanation:

different cells come in all different sizes there are many different cells

You might be interested in
An _____ is a drug that mimics or increases a neurotransmitter's effects, whereas an _____ is a drug that blocks a neurotransmit
alexdok [17]
Agonist/antagonist
 Agonist are drugs that bind and activate a receptor with effecting the response.If the effect results in maximum response it is considered as full agonist. However if the drug that binds to the receptor results only into partial efficacy in relation to the full activation of the receptor, this is considered as partial agonist.

Antagonist are drugs that blocks a biologic response of a hormone or another drug. They usually have affinity to the receptors but has no efficacy. This drug will just inhibit the activation of the receptors by the aganist.
5 0
3 years ago
The third stage of digest
Strike441 [17]
Food enters the stomach during the third stage of digestion, hope this helps. 
8 0
3 years ago
Read 2 more answers
Explain how the environment and economy has impacted because of coronavirus
aleksley [76]

Answer:

Corona Virus is helping the environment because people aren't constantly driving around and polluting the air. The economy, however, is dropping due to people not working and not making money and therefore, not spending as much money.

3 0
3 years ago
Read 2 more answers
The nurse is reviewing the medication administration record (mar) of a client at 39 weeks' gestation and notes that she is order
Orlov [11]

The priority after administering is to assess fetal heart rate. After administering an opioid to a laboring mother, the main concern is to evaluate the effect on the fetus. Opioid administration can cross the placental obstruction with signs as well as measuring heart rate and variability. Subsequently after birth, there may be a reduction in attentiveness. Maternal factors of a reduced blood pressure, constipation and dry month are of a lesser importance.

5 0
3 years ago
Which option explains why genes are sections of chromosomes, but chromosomes are not made up of genes?
Nitella [24]

Answer:

A chromosome is made of a very long strand of DNA and contains many genes (hundreds to thousands). ... The genes on each chromosome are arranged in a particular sequence, and each gene has a particular location on the chromosome (called its locus).

Explanation:

8 0
3 years ago
Other questions:
  • With the aid of the geological time chart, write comparatively on chordate evolution through time​
    14·1 answer
  • Describe the differnt phrases and changes of female reproductive system during a menstruation cycle
    13·1 answer
  • What is the first way in which biology researchers present the results of their latest research?
    9·2 answers
  • The term used to identify identical strands of DNA held together by a centromere
    6·1 answer
  • After .......blank....... ,the nucleus of the parent cell has divided into two new nuclei ?
    7·1 answer
  • What are the first three steps of scientific inquiry are related.
    9·1 answer
  • What causes a movement between the land in the ocean
    14·1 answer
  • What are the components of plasma in the human blood​
    8·1 answer
  • Please help meeeeeeee
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!