1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flura [38]
2 years ago
15

Which two species are most closely related?

Biology
1 answer:
faust18 [17]2 years ago
4 0

Answer:

Two species (B & C) are more closely related to one another than either one is to a third species (A) if, and only if, they share a more recent common ancestor with one another (at Time 2) than they do with the third species (at Time 1).

Explanation:

You might be interested in
What is the likeliest limiting factor restricting phytoplankton to approximately the top ten feet of the ocean, rather than deep
serg [7]

Quality of light is the limiting factor restricting phytoplankton to approximately the top ten feet of the ocean, rather than deeper

Explanation:

When sun rays pass through the water in the oceans, they are quickly diffused and cannot penetrate very deep into the deep water layers. Remember that phytoplanktons are photosynthetic organisms and hence require sunlight to manufacture their own food. They, therefore, cannot grwo in deeper layers of the oceans. They are only found in the photic zone.

The quality of light is especially of most importance and hence the major limiting factor. Red light, of longer wavelength, and which is the major wavelength of light that is used the most by photosynthetic organisms, diffuses very fast than blue light when it passes through water. Therefore the more reason phytoplankton is found in the top ten feet of the ocean, rather than deeper.

Learn More:

For more on phytoplankton check out;

brainly.com/question/8777727

#LearnWithBrainly

4 0
3 years ago
What ecological level consists of all the ecosystems found on earth?
Wittaler [7]

Answer:

Levels of organization in ecology include the population, community, ecosystem, and biosphere. An ecosystem is all the living things in an area interacting with all of the abiotic parts of the environment.

Explanation:

Hope this helps! :)

5 0
2 years ago
Which of the following is the best description of a fissure? It's a volcano that
lesya692 [45]

B. is a long crack, which releases lava, steam,  and gases

Explanation:

A fissure is a long crack which releases lava, steam and gases into the environment. Fissures are mostly associated with volcanic bodies.

A volcano is an igneous structure by which lava erupts on the earth surface.

  • most volcanoes have fissures through which they release materials into the environment.
  • these features are usually permeating cracks into the deeper magmatic body.
  • they often times acts as conduit for magma to reach the surface.
  • in a volcanic terrain, fissures can provide good clues to the occurrence of an eruption.

learn more:

volcanic bodies brainly.com/question/5055821

#learnwithBrainly

3 0
3 years ago
Sand dunes often have a wavy surface what creates this kind of surface
trasher [3.6K]
The Bottom Line. Dunes and ripples are both bedforms: piles of stuff that is moved along the ground by the wind (or by some fluid, like water). They are formed in different ways, taking anywhere from minutes to millennia to respond to changes in wind patterns
7 0
2 years ago
ead the following scenario and answer the question below Human activities, including fossil fuel combustion, farming, and defore
vagabundo [1.1K]

Answer:

The given blank can be filled with secondary succession.

Explanation:

In the given case, the events will lead to secondary succession. It is a kind of ecological succession in which the animals and plants get colonize again in habitat after a major disturbance like a devastating hurricane, wildfire, or human activities. The mentioned things can substantially change an area, however, has not entirely made it lifeless.

Secondary succession occurs in the area where the disturbance did not eradicate all the life and nutrients from the environment, that is, different from primary succession in which the development of biological community takes place where no life had prevailed before.

6 0
3 years ago
Other questions:
  • Adaptation by natural selection is the process that allows individuals to adapt to their environments.
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A baseball is dropped from 100 meters above the surface of the Earth. The baseball falls to the ground. What would happen if thi
    9·1 answer
  • Humans, and other organisms that reproduce through sexual means, obtain approximately half of their DNA sequence from the father
    11·2 answers
  • _______ is a macromolecule that holds cell information in a coded form. Made of sugar
    10·1 answer
  • The expected phenotypic ratio of a dihybrid cross is
    9·2 answers
  • Help with this plz!!
    11·1 answer
  • Which single factor would most likely account for this trend?
    11·1 answer
  • Wasp larvae can grow inside a type of caterpillar known as the Tomato Hornworm. The caterpillars
    9·1 answer
  • Pl any onee here join<br>mgz-omtm-vbu​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!