1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ArbitrLikvidat [17]
3 years ago
7

For fertilization to occur in humans, only one sperm is needed to weaken the barrier that surrounds the egg.

Biology
1 answer:
photoshop1234 [79]3 years ago
8 0

Answer:

False

Explanation:

Approximately 200 out of 200 million sperms ejaculated during intercourse reach the general vicinity of the egg.  They sperms must undergo capacitation during which dilute inhibitory factors fluids of the female reproductive tract weaken the membrane of the sperm head so that head of the sperm can be broken easily when it came in contact with the egg.

The first sperm to reach an egg isn’t the one to fertilize it because the egg is surrounded by a gelatinous membrane called the zona pellucida. Outside this layer, a layer of small granulosa cells also present.

Therefore, it requires numerous sperm to clear a path through these barriers before one of them can penetrate the egg and fertilize it.

You might be interested in
Which substance is a compound?<br> water<br> gold<br> oxygen<br> hydrogen<br> HURRY PLEASE !!
Ray Of Light [21]
Oxygen is a compound.
7 0
3 years ago
Read 2 more answers
Photosynthesis what's in a leaf pogil answer key
kolezko [41]

Photo means light and synthesis means formation. It is a process of formation of food in the presence of light.  

It takes place in green plants because they contain chlorophyll and chlorophyll is one of the vital reactant required for this process.  

The light gets trapped in the leaf and process the formation of glucose.  

Leaf is where photosynthesis takes place. When glucose is formed in leaf, it is transported to other parts of the plants with the help of the vascular bundles.


8 0
3 years ago
Second-generation antihistamines such as loratadine (claritin) are prescribed for seasonal allergies because they:
Evgen [1.6K]
Antihistamines are drugs that are used to treat allergic rhinitis (both seasonal and perennial) and other form of allergies that cause hives or urticaria. They can give relief when a patient has nasal congestion, sneezing or hives because of pollen, dust, or animal allergy (allergens). Second generation antihistamines such as loratidine are prescribed for seasonal allergies because they are less sedating than the first generation antihistamines.  
6 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Describe the role. of the liver in regulating the concentration of glucose in the body​
leva [86]

Answer:

The liver stores glucose to power the cells during periods of low blood sugar. Skipping meals and poor nutrition can lower blood sugar. By storing glucose, the liver makes sure that blood glucose levels remain steady between meals and during sleep. When blood glucose falls, cells in the pancreas secrete glucagon.

<h2>Have a nice day!!</h2>
4 0
2 years ago
Read 2 more answers
Other questions:
  • 4. What are some concerns that arise as valuable soil becomes rarer?
    6·1 answer
  • When fertilization occurs, what do we call the resulting cell? What is the term given to the cell according to the number of chr
    6·1 answer
  • Genetic diversity helps a species survive. What is genetic diversity?
    9·2 answers
  • In the late Devonian era, the seas began to recede and the land became more fertile. These environmental changes resulted in the
    7·1 answer
  • The gradual change and buildup of organisms in an environment
    11·2 answers
  • Walking alone late one night, you are startled by a moving shadow that you glimpse out of the corner of your eye. The _______ di
    14·1 answer
  • A frustrated 26-year-old female has sought a referral to a dermatologist in an effort to resolve her sweating and body odor whic
    11·1 answer
  • “What is the total magnification of a sample with an ocular lens power of 15X and using a 40X objective lens?”
    13·2 answers
  • Which of the following is true:
    10·2 answers
  • How can you use word components to relate medical terms to the structure and function?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!