1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zvonat [6]
2 years ago
13

True/ False: Other than gametes in eukaryotic cells, each somatic cell contains a complete set of an organisms genome which is w

hy gene expression is necessary. *
Biology
1 answer:
sasho [114]2 years ago
4 0

Answer:

  • <u>Option-</u>True.
  • Other than gametes in eukaryotic cells, each somatic cell contains a complete set of an organisms genome which is why gene expression is necessary.

Explanation:

  • As the somatic cell contains the set of information relating the genome of the organism that is much likely similar to that of the parent cell. While, the somatic cell are not termed  as those used in the reproduction process i.e sperm and ova. But, it is related to the different system inside the animal cell's body.
You might be interested in
What happens when you mix vinegar and baking soda?
Llana [10]
When vinegar and baking soda mix hydrogen ions in the vinegar react with the sodium and bicarbonate ions in the baking soda
6 0
2 years ago
Read 2 more answers
What is the stuff between bones in a joint?
igor_vitrenko [27]
Ligaments connects bones together to form a joint...

this is any help?
3 0
3 years ago
Matter is made up of motionless particles.<br> True<br> False
artcher [175]

Answer:

t

Explanation:

7 0
3 years ago
A molecule that has one atom in its particles and formula *
Paha777 [63]
Hola amigo mi no hablas ingles mi only hablas español
5 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • Oxygenated blood is pumped to the body by the _____.
    6·2 answers
  • The process by which a final product acts as an inhibitor to the enzyme that catalyzes the commitment step in a metabolic pathwa
    12·1 answer
  • All autotrophs produce valuable organic molecules. What makes these organic molecules so valuable to living organisms
    12·1 answer
  • When we have stomach disorder, I we take an acid to slove the problem. How does it help? Support your answer with equation.
    11·1 answer
  • What is the difference between an cell and a tissue?
    12·2 answers
  • Michele believes she cannot lose weight because she has a slow metabolism. Of the research she has done on the subject, which wo
    15·2 answers
  • What process must the cell undergo to have genetically different cells at the end of cell division?
    14·1 answer
  • A set of genetic material on chromosome that control a particular trait is referred to​
    12·1 answer
  • Where are proteins, such as enzymes, that are to be secreted from the cells produced?.
    10·1 answer
  • Ribosomal subunits are large complexes composed of numerous polypeptides and at least one rrna molecule. Which subunits include
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!