1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
3 years ago
12

What was the connection between the political situations in Iran and Nicaragua during the mid-1980s?

Biology
1 answer:
Ilia_Sergeevich [38]3 years ago
6 0
The connection between the political situations in Iran and Nicaragua during the mid-1980s was both countries fought the USSR with weapons supplied by the United States. The correct answer is D. 
You might be interested in
To be considered a living thing, it must have...
Kay [80]
All of the characteristics of life, hope I’ve helped ;)
8 0
3 years ago
What controls the direction of a molecule, such as oxygen, involved in passive transport?
Grace [21]
The nucleaus controls everything within cells

4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
How do the functions of DNA and RNA differ?
SpyIntel [72]

Answer:

DNA is functional is the transmission of genetic information. It forms as a media for long-term storage. RNA is functional is the transmission of the genetic code that is necessary for the protein creation from the nucleus to the ribosome. The DNA is a double-stranded molecule that has a long chain of nucleotides.

3 0
3 years ago
Propose an explanation as to
Marat540 [252]

Answer:

The intense and constant activity of insulin synthesis explains why pancreatic beta cells possess more rough endoplasmic reticulum and ribosomes than other cells.

Explanation:

Both ribosomes and the rough endoplasmic reticulum are necessary for protein synthesis to occur. In cells whose function is to produce substances, such as glands, the content of these cellular structures is higher in order to fulfill their function.

The pancreatic beta cells, located in the islets of Langerhans, have the function of synthesizing insulin, an endocrine hormone in charge of regulating the glucose content in the blood. <u>Because the beta cells constantly produce insulin, their content of rugged endoplasmic reticulum and ribosomes is high, in order to satisfy the demand for this hormone in the body</u>.

5 0
3 years ago
Other questions:
  • 1. How is the process of photosynthesis central to sustaining life on Earth?
    8·1 answer
  • The law of states that traits are passed from parents to offspring independently of one another., therefore the traits are _____
    5·2 answers
  • Which explanation describes why Archaea is placed into a different domain from bacteria?
    13·1 answer
  • For what cell process is the mitochondria (picture below) responsible?
    6·1 answer
  • Scientific inquiry requires logical ideas that
    8·1 answer
  • 1.Are there any cures or medication to relieve the effect of the Alzheimer’S disease? If so, what are they
    9·1 answer
  • Which of the following is an example of post-transcriptional control of gene expression?
    12·1 answer
  • Muscle cells need to quickly convert energy from molecules into a usable form. For this reason, which of the following do muscle
    12·1 answer
  • As you look at the general trends of the graph, what happens to the biodiversity when a mass extinction happens? Why?
    5·1 answer
  • Sa remarcate pretution has led to an increase in global temperatures, which is causing darsers to meet faster. If this trend con
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!