The green sample possibly contains algae or some other sort of bacteria
The answer is; 24 hours.
Scientists called the full rotation of the earth a day and divided it into 24 hours on the clock. This means from sunrise to next sunrise. They also divided the earth into latitudes that indicate time zones. When one point on earth rotates and return to the same position in space, it has lapsed 24 hours.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Natural resource management deals with managing the way in which people and natural landscapes interact.
Answer:
Yes
Explanation:
Hunting in groups is much more effective than hunting solo because you have more people to help catch whatever it is you're trying to get.