Answer:
Scientific investigations produce evidence that helps answer questions and solve problems. If the evidence cannot provide answers or solutions, it may still be useful. It may lead to new questions or problems for investigation. As more knowledge is discovered, science advances.
Answer:
B. F1
Explanation:
Plants used in first-generation crosses were called P, or parental generation, plants (Figure 8.3). Mendel collected the seeds produced by the P plants that resulted from each cross and grew them the following season. These offspring were called the F1, or the first filial (filial = daughter or son), generation.
Environmental impact and radioactive waste
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
The right answer is it can be attributed to similarities among organisms in proteins and nucleic acids (especially in their coding regions in their genome).
Genomes consist of coding regions, which correspond to genes, and non-coding regions. The coding part is the one that gives the proteins that are involved in the structure and metabolism of the individuals. if two individuals have a similar protein-giving genome, then they will probably have the same structure and metabolism.
