1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
14

Pls, I need help with this! Biology Thank you :)

Biology
1 answer:
topjm [15]3 years ago
8 0

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

You might be interested in
In an experiment, a student mixed a substrate and an enzyme. What is the reaction?
cupoosta [38]
The reaction was that the activation energy was lowered and the bonds were changed. They combine briefly and form an enzyme-substrate complex. 
Hope this helped! 

ps - trying to get to a new rank so would really really appreciate it if you gave me a brainliest answer. thanks!
8 0
3 years ago
When a body cell of a potato divides how many chromosomes will each of the new cells contain?
eimsori [14]

Potato cells contain 48 chromossomes in their DNA which means that when a cell divides, each daughter cell will have 24 chromossomes since:

48 / 2 = 24


Hope it helped,


BioTeacher101

5 0
3 years ago
Read 2 more answers
A plant that normally has relatively few, long internodes develops short and more frequent internodes. Which
Lisa [10]

Answer:

B

Explanation:

3 0
3 years ago
Which of the following is an advantage of sexual reproduction over asexual reproduction?
nataly862011 [7]
Answer is D because the other three are illogical
5 0
4 years ago
Read 2 more answers
What ability of individual stem cells is described by the term totipotent?
I am Lyosha [343]
Totipotent stem cells have the ability to develop into any kind of cell found in the human body.
When the sperm fertilizes the egg, creates the zygote which is the fist totipotent cell. After that, in the first cell divisions more totipotent cells are produced. Within several days, these totipotent cells produce even more totipotent cells and after four days the cells begin to specialize.
7 0
3 years ago
Other questions:
  • Physiologically, the effects of anorexia are similar to the effects of starvation: basal metabolic rates _____, and blood levels
    7·1 answer
  • What does lifestyle have to do about overweight/obesity?
    7·2 answers
  • What do areas of high albedo have in common?
    11·2 answers
  • Removal of plaque from inner lining of an artery:
    10·1 answer
  • Which of the following are not biotic or abiotic factors in an ecosystem? (choose one) answer ASAP, I really need help
    13·1 answer
  • Question 8 of 24
    14·1 answer
  • .....................................................
    7·2 answers
  • The only step in cellular respiration that produces no energy (ATP) is:
    13·1 answer
  • Please help me with this question
    14·2 answers
  • Plant which propagates with the help of its leaves is.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!