1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
14

Pls, I need help with this! Biology Thank you :)

Biology
1 answer:
topjm [15]3 years ago
8 0

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

You might be interested in
What factor influences Beach erosion during a hurricane, the most? Storm surge?
nydimaria [60]
Factor<span> in the generation of large coastal </span>surges<span>. Corresponding ... larger than </span>Hurricane<span> Camille </span>during<span>its entire passage through the Gulf of ... Consequently, </span>most hurricane surge<span> studies, for both ... </span>factors<span>for </span>hurricane surge<span> response (</span><span>e.g., Berke et al. 1984). ... cal </span>storm<span> events with </span>coastal erosion<span> and overwash</span>
7 0
3 years ago
explain one reason why the population of marsh grasses might increase if the population of herons decrease
gogolik [260]
Herons are very large birds, and due to their intimidating size, they have very little predators. They have a varied diet and consume many different prey (fish, snakes, amphibians, and probably many other small animals). If the population of herons would decrease, the population of the other organisms living in the same environment would increase since they would have a greater chance at survival (since they are not being eaten by the herons)
8 0
3 years ago
Consider the uninoculated tube.
Nostrana [21]

The uninoculated tube is considered to be a negative control because a negative control is an effect of having to show no response. Am uninoculated control is where  organisms are not being inoculated such as having a culture bacteria of not being inoculated with an organism.

3 0
4 years ago
What could be one possible effect on human health due to an oil spill?
mojhsa [17]

Answer: C. Oil from the oil spill could enter aquatic organisms, like fish, which could make people sick.

Explanation:

Oil spill in water body can be caused by the industrial oil discharge, emission of vehicle oil in water body.

The oil may contain toxic chemicals which could be consumed by the fishes or other aquatic organisms. The fishes and other edible aquatic organisms if consumed by human beings can make people unhealthy or sick.

7 0
3 years ago
Read 2 more answers
Help me with these questions
ANTONII [103]
The object is about to go/going down a hill, its increasing. b

5 0
4 years ago
Read 2 more answers
Other questions:
  • Deepwater waves occur when the depth is
    8·1 answer
  • Are atoms able to be divided by a chemical reaction?
    8·1 answer
  • Male peacocks have tail feathers that make up about 60% of their body length. during the mating season they contract muscles to
    8·1 answer
  • 20. Many years 90, scientists working with cells developed what is now known as the
    9·1 answer
  • Which of the following prevents blood from flowing backward through the circulatory system?
    11·1 answer
  • Which best describes the nucleus of an atom?
    7·2 answers
  • Do you think mouse offspring will always look like their parents? ______________________
    15·1 answer
  • Living things need carbon to make
    7·2 answers
  • Which of the following is NOT a function of the liver?
    7·2 answers
  • In pea plants, Round is dominant to Wrinkled and Yellow is dominant to green. If two pea plants that are both heterozygous for b
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!