1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
14

Pls, I need help with this! Biology Thank you :)

Biology
1 answer:
topjm [15]3 years ago
8 0

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

You might be interested in
What type of blood vessel usually carries oxygen rich blood
tangare [24]

Answer: artery

Explanation:

The artery is the blood vessel that carry oxygenated (oxygen-rich) blood away from the heart while the vein carry deoxygenated(oxygen-poor) blood from the body to the heart.

Hence, all arteries carry oxygenated blood except pulmonary artery while all veins carry deoxygenated blood except pulmonary vein.

5 0
4 years ago
Read 2 more answers
Which organelle is the site of cellular respiration, where food is broken down to release
skelet666 [1.2K]

Answer:

Mitochondria

Explanation:

If ever in doubt, just remember: Mitochondria is the powerhouse of the cell

4 0
4 years ago
What happened if we add normal saline instead of PBS during beta amylase extraction?​
Alchen [17]

Answer:

hi

Explanation:

3 0
3 years ago
HELP GUYSSSSS PLS
pochemuha

Answer:

Insulin helps the cells absorb glucose, reducing blood sugar and providing the cells with glucose for energy. When blood sugar levels are too low, the pancreas releases glucagon. Glucagon instructs the liver to release stored glucose, which causes blood sugar to rise.

3 0
3 years ago
A completed Punnett square shows all of the following except
IgorLugansk [536]

Answer:

A completed Punnett square shows all of the following except "the actual results of a genetic cross"

Explanation:

As we know, that genetic crossing is the determined breeding of the two specific individuals which results in the mixing of the genetic materials that are visible in the offspring. These crosses can be done in the different models like plants, yeasts, flies and also in the mice. These organisms are mostly used for the dissection to know the genetic processes or can be used for creating some novel characteristics. They are mostly two types i.e. monohybrid and dihybrid cross.

4 0
4 years ago
Other questions:
  • Chemical bonds that involve the total transfer of electrons from one atom or group of atoms to another are called
    5·1 answer
  • The parts that are either directly or indirectly related to each other in a system are known as what?
    13·1 answer
  • Cells in the root divide many times as the root grows longer and thicker. With each cell division, the chromosomes are divided b
    6·1 answer
  • Which of the following statements is FALSE? A. Biological systems are highly ordered so entropy changes are not relevant.B. The
    8·1 answer
  • What is one difference (other than distance from the sun) between terrestrial planets and Jovian planets? Group of answer choice
    12·1 answer
  • Use the periodic table to identify the name of atomic number for each element below. (Give the name not the chemical symbol for
    14·2 answers
  • Please help im really stuck pleasE
    13·1 answer
  • Find the base of the following:
    14·1 answer
  • If an organism is a protostome, what else can you conclude about its body plan?
    13·1 answer
  • What is one way that biotechnology can most directly improve the marine environment?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!