1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rainbow [258]
3 years ago
14

Plant like Protist are Heterotrophic . True False

Biology
1 answer:
Nonamiya [84]3 years ago
5 0

Answer:

True!

Explanation:

Though, some protists can be unicellular and others can be multi-cellular. Animal protists are heterotrophs, and plant like protists are autotrophs.

You might be interested in
How do animals and other organism access glucose for cellular respiration?
fomenos

▪▪▪▪▪▪▪▪▪▪▪▪▪  {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪

Correct choice is " Eating Carbohydrates "

Animals and other organisms access Glucose for cellular respiration, by eating <u>Carbohydrates</u> .

5 0
2 years ago
13.The simplest pure substances that cannot be broken down into any other substances are called
GuDViN [60]

Answer:

Element

Explanation:

Element is a pure substance that cannot be broken down.

3 0
2 years ago
The production of four haploid gametes from one mother cell is completed during
Rudik [331]
This is a product of meiosis
7 0
3 years ago
How do hydrochloric acid and bile salts help digest food?
yan [13]
HCL is guilty for triggering the release of enzymes such as pepsin which are essential for the digestion of protein. Bile contains bile acids, which are critical for digestion and absorption of fats and fat-soluble vitamins in the small intestine.
4 0
3 years ago
use the base pairing rules to write the sequence that would pair with the following sequence: Agatcct
lukranit [14]

Answer:

TCTAGGA

Explanation:

The deoxyribonucleic acid (DNA) molecule consists of two single-strands, which are composed of four different types of nucleotide bases: Adenine (A), Thymine (T), Guanine (G) and Cytosine (C). These two DNA strands run in an anti-parallel direction to each other. According to the base-pairing rules, Adenine always pairs with Thymine, while Guanine always pairs with Cytosine. In DNA, Thymine and Adenine form two hydrogen bonds between them, while Guanine and Cytosine form three hydrogen bonds between them.

8 0
3 years ago
Other questions:
  • Based on this information the statement "traits are passed from parents to offspring independently to one another" is??
    9·1 answer
  • Why might introduction of exotic species disrupt an ecosystem?
    6·1 answer
  • Which of the following is true of carbon dioxide exchange? Select one: a. Carbon dioxide is produced in the mitochondria and cyt
    13·1 answer
  • Which one is true ??
    5·1 answer
  • Why might fatty acid,amino acids and nucleic acid increase the hydrogen ion cocenntration
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • 6. The smallest idea can grow to the point that it will define you or destroy you. Explain what this
    7·1 answer
  • Please i need your help
    15·1 answer
  • How do you increase the rate of a chemical reaction?
    13·1 answer
  • Receptor-mediated endocytosis is the mechanism for transport of:.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!