Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
contractile vacuole.
Explanation:
Contractile vacuole is an organelle which is damaged from the antibiotic and as a result the cell burst. The main function of contractile vacuole is to regulates the quantity of water inside the cell. If the contractile vacuole is damaged so it does not regulate water required by the cell as a result more water enters inside the cell which results in the bursting of the cell.
The immune system, and the excretory system
(Honestly, all of them work to keep us 'healthy', but I believe these are the ones you're looking for)
Answer:
Explanation:The large molecules necessary for life that are built from smaller organic molecules are called biological macromolecules. There are four major classes of biological macromolecules (carbohydrates, lipids, proteins, and nucleic acids), and each is an important component of the cell and performs a wide array of functions. Combined, these molecules make up the majority of a cell’s mass. Biological macromolecules are organic, meaning that they contain carbon. In addition, they may contain hydrogen, oxygen, nitrogen, phosphorus, sulfur, and additional minor elements.
Carbon
It is often said that life is “carbon-based.” This means that carbon atoms, bonded to other carbon atoms or other elements, form the fundamental components of many, if not most, of the molecules found uniquely in living things. Other elements play important roles in biological molecules, but carbon certainly qualifies as the “foundation” element for molecules in living things. It is the bonding properties of carbon atoms that are responsible for its important role
I think the correct answer is B
