1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
8

Stem cells have the ability to divide through - and produce unspecified cells

Biology
1 answer:
Aliun [14]3 years ago
8 0
Stem cells can be developed into a required tissue because of their ability to differentiate into any tissue. ... The process by which unspecialized stem cells become specialized is called differentiation. Differentiation involves many stages and at each stage the cells becomes more specialized
You might be interested in
Which cell organelle’s function resembles the function of the brain in higher animals?
raketka [301]
The nucleus resembles the brains function.
7 0
3 years ago
Which of the following is a part of the diencephalon.
emmainna [20.7K]

Answer:

d. all of the above

Explanation:

The diencephalon is a part of the brain located inferiorly and anteriorly to the corpus callosum, part of the telencephalon, and superior to the midbrain, delimited by the latter by an imaginary line that runs from the nipple to the posterior commissure (epithalamus). The diencephalon consists of: thalamus, hypothalamus, epithalamus, metatalamus and subthalamus. For this reason, we can conclude that the correct answer to your question is "d. All of the above".

8 0
3 years ago
During the nucleic acid practice, write the statement that refers to nucleic acids in the space below
brilliants [131]

Hello. You did not present the answer options, which makes it impossible for this question to be answered accurately. However, I will try to help you in the best possible way.

Nucleic acids are known as DNA and RNA. they are essential for all cells, since it is through them that genetic information is stored and encoded. They are essential for the synthesis of proteins, carbohydrates, lipids and the regulation of intermediate metabolism, in addition to acting by activating or inhibiting enzymes.

6 0
3 years ago
Accurate description of the organisms living on this bread
antoniya [11.8K]

Answer:

They probably tiny living organisms called yeast.

6 0
3 years ago
1. Explain the relationship between the food we eat and energy in the body.
Marina CMI [18]
The food we consume is then processed and essentially extirpated into two forms, waste and nutrients. The nutrient rich category is used, or stored for when needed. Similarly, sugar is either used for energy once consumed, or stored in fat cells for when needed.
4 0
4 years ago
Other questions:
  • recently CA has been experiencing many wildfires to the point that many areas of land no longer have any living wildlife remaini
    12·1 answer
  • A thermometer contains liquid mercury, and the volume of that mercury grows as the temperature grows, allowing us to make accura
    15·1 answer
  • Convert the volume of CO2 you measured in the glucose reaction to moles of CO2 using the Ideal Gas Law to solve for n. Assume P
    5·1 answer
  • What biodiversity restoration method can biologists follow to increase the density of trees and the canopy thickness in an area
    13·2 answers
  • Select the correct statement regarding epithelia.A) Simple epithelia form impermeable barriers.B) Stratified epithelia are prese
    12·1 answer
  • What happens to certain nutrient molecules after they pass into muscle cells?
    5·1 answer
  • Examine the diagram representing a section of an organic molecule.
    8·1 answer
  • Clouds are formed when
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Critical Thinking Evaluating Viewpoints
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!