1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
5

A researcher performed an experiment in which he exposed young potato plants to a radioactive form of carbon dioxide gas contain

ing
carbon-14 instead of carbon-12. After several weeks, the researcher took tissue samples from the plants and isolated several different
types of organic molecules from them.
In which of the following types of molecules might the researcher find carbon-14?
A.
nucleic acids
B.
lipids
c. amino acids
D.
all of these
Biology
1 answer:
wolverine [178]3 years ago
4 0

Answer:

d

Explanation:

You might be interested in
Should Californians care about specific organisms losing their habitat and support laws that would help mitigate those losses ?
iogann1982 [59]
This devastation has wrecked many ecosystems. The state has lost 90 percent of our coastal wetlands and inland wetlands, 99 percent of our riparian areas, and most of our native grasslands. California is also a critical nexus for the biodiversity loss taking place in our oceans.
5 0
2 years ago
At which stage of scientific inquiry would scientists find out if their hypotheses were supported by their data?
Troyanec [42]
Most probably the stage of testing. 
6 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Birds lay eggs that have much harder shells than reptile
mamaluj [8]

Answer:

D

Explanation:

bird eggs don't need additional moisture that some reptiles absorb with their eggshells

4 0
3 years ago
Read 2 more answers
What is the MIT for chicken?
natka813 [3]

Answer:

Mutation Insert Telephone or "MIT"

Explanation:

4 0
3 years ago
Other questions:
  • What is a likely advantage of having a multicellular body that consists of fine filaments (hyphae)?
    14·1 answer
  • .....................................................
    7·1 answer
  • How does a cladogram relate organisms to one another? ( in own words)
    9·1 answer
  • How had technology changed farming
    14·2 answers
  • What is a protron needed for
    6·1 answer
  • ___________ is a structure that contains spores and is located on the underside of fern leaves. Basidium Bacillus Cilium Sorus
    8·1 answer
  • What is karytoyping used for
    9·2 answers
  • What subatomic particles make up the nucleus of an atom? Check all that apply.
    9·1 answer
  • The term “survival of the fittest” means the organism that is ___ will survive.
    6·2 answers
  • What is the function of lysosomes?​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!