Answer:
During this period, the uterus shrinks back to its original state in a process called <u>invulotion</u><u>.</u>
Explanation:
Pa Brainliest Po
=)
Answer:
The answer is FALSE.
Explanation:
Schizophrenia is a personality disorder that affects a person's ability to think, feel and behave clearly.
Although there is a very strong genetic component to schizophrenia, genes alone do not completely explain the illness. Rather it is believed that genes do not directly cause schizophrenia, but do make a person vulnerable to developing the disease alongside other factors such as the environment and altered brain chemistry and structure.
They are all necessary for photosynthesis to occur.
Kidneys for transplant can come from a living or a cadaver. Nephrectomy is the surgical removal of one or both kidneys. It is done by removing a healthy kidney from what you call a donor.They are usually to treat kidney diseases and injuries.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
