1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nutka1998 [239]
4 years ago
9

9E and 9F please. I'm unsure about the answers.

Biology
1 answer:
tensa zangetsu [6.8K]4 years ago
3 0
9F you will talk about preparing more sucrose solutions at narrower intervals and cross matching the results.

9E i am not sure but I think it might be slightly higher than 0 , like maybe 1 or 2 as the change in mass when it was in 0 isn't that big.
You might be interested in
The word leg refers only th part of the body be tween the knee and the ankle
Alex777 [14]
False. The leg consists of the femur, patella, tibia and fibula. Which is the entire leg.
5 0
3 years ago
Which is incorrect about restriction enzymes? they are key tools that make genetic engineering possible. they are found in bacte
BaLLatris [955]

They are found in bacteria and eukaryotes is false

8 0
3 years ago
Hemlocks are a common type of tree in the northern forests of the United States. In studying one forest, a forester noticed that
Vlada [557]

Answer:

b. making an observation and asking a question

Explanation:

In scientific method there need to be a situation to be study. In this description, the scientist first observed that in a certain region there is some kind of trees and the other variable is the great amount of deer.

After making different observations, and some research of other areas similar to the one that is study, she is asking what is the relation among the animals and the trees.

The next step will be to formulate a hypothesis using all the data and the two variables that she observed.

8 0
3 years ago
Ocean salinity varies from place to place due to differing conditions in the environment
horrorfan [7]
This answer is TRUE !! Hope this helps you out a little :)
3 0
3 years ago
Why are the intestines the largest parts of the alimentary canal?
anygoal [31]

The parts of the alimentary canal listed in order are the mouth, pharynx or throat, esophagus, stomach, small intestine and large intestine. The alimentary canal is the digestive system and includes the parts of the body with which food comes in contact from eating to waste elimination.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which portion of the ear is responsible for sound transduction?
    14·1 answer
  • Molecules that are not able to independently diffuse across a membrane may still move down their concentration gradient by
    10·1 answer
  • Movement of water on or near the surface of the water is called a deep current. Please select the best answer from the choices p
    11·2 answers
  • Which of the following statements is false? A. The primary electron acceptor is found in the reaction-center complex of a photos
    7·1 answer
  • In which direction does RNA synthesis proceed?
    14·1 answer
  • We know a lot more about animals and plants than Darwin did, and still, not a single case is known to me of a complex organ that
    5·1 answer
  • A team of scientists is studying the inheritance of eyelash length in humans. Eyelash length is either long or short, and is con
    5·1 answer
  • What are the two processes used by producers to obtain energy
    9·2 answers
  • To produce transgenic bacteria that make insulin, which of the steps listed below would a scientist do FIRST?
    8·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!