1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
5

What problems would you expect to observe in an ecosystem without secondary consumers? Be sure to answer this question in paragr

aph form using complete sentences.
Biology
2 answers:
Tasya [4]3 years ago
5 0

lots of waste and dead leaves and things like that

dont plagarise ;)

gizmo_the_mogwai [7]3 years ago
3 0

There would be a lot of herbivores. Also their would be a lack of vegetation eventually in their area because the secondary consumers will not eat most of the primary consumers like deer and squirrels which in turn will eat all of the vegetation.  This would conclude that the herbivores would eventually die do to starvation, that is why the meat eaters are needed in a ecosystem.

You might be interested in
Which nucleic acid provides the master code for protein synthesis?
ioda
MRNA it is the messenger, for it "feeds" information
8 0
3 years ago
Read 2 more answers
Determine whether each phrase describes ponds or lakes.
VikaD [51]

Answer:

Ponds:

Shallow & warm

A lot of plant and animal life

Many nutrients

Lakes:

Large, deep, cold

Little sunlight near bottom

Plants mainly along the shore

6 0
3 years ago
Read 2 more answers
What information do you enter in the food prep list?
olya-2409 [2.1K]

Food preparation is the process that involves planning and preparing of meals. The food prep (preparation) list is a sheet that contains information of ingredients and the amount of each of the ingredients required when preparing a particular dish. The food prep list is part of a recipe which makes the kitchen much more organized and prevents wastage and excessive use of ingredients.


6 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Hihihihi please help
lara [203]

Answer:

I think is B because at stage 4 we can observe that different kinds of cell formed(the cell on the edge is different from the inner cell)

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • An amoeba eats some food. Which organelles will help store and digest it?
    15·1 answer
  • Which is an accurate description of the processes used to turn the DNA code of a gene into a protein? A) Transfer RNA molecules
    12·2 answers
  • Infection with H. pylori is associated with increased risk of peptic ulcers, but also seems to afford some protection from _____
    9·1 answer
  • In which of the female's reproductive structures would embryonic or fetal pigs be found
    11·1 answer
  • John collected a sample of pond water to look for tiny living microorganisms. Which type of microscope does John need to use to
    12·2 answers
  • When earth worms add their waste in the soil and die in the soil they are contributing to the formation of ?
    11·1 answer
  • Energy produced by cellular processes is stored as
    10·1 answer
  • Will mark brainliest!
    6·1 answer
  • Adults of species in the order ___ have 2 wings and the greatest variety of mouthparts. Group of answer choices Isoptera Coleopt
    6·1 answer
  • Examine the equation.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!