1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
13

Does eukaryoticcells contain ribosomes and mitochondria

Biology
1 answer:
arlik [135]3 years ago
7 0
Yes. Ribosomes are also present in all cells.
You might be interested in
PLEASE HURRY!!!!!
lara31 [8.8K]

Answer:

a) decreased soil nitrogen due to the harvesting of crops

Explanation:

I looked at my notes and made a 100 on the quiz.

6 0
4 years ago
amylase is a chemical that decomposes starch into maltose and dextrin. which best describes the role of amylase in the human bod
viva [34]

Answer:

An enzyme that aids in digestion.

Explanation: Digestion begins in the mouth and continues throughout the GI track. Amylase is found in salIva and begins to break down maltose and dextrin in the mouth. You can also tell amylase is an enzyme because the suffix “-ase” refers to enzymes.

3 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Cellular respiration is the process that allows living organisms to extract energy from nutrients. What is the main
jeyben [28]

Answer: the second one

Explanation: I just took the quiz

8 0
3 years ago
Read 2 more answers
What is CdK?<br><br> A. A protein substrate<br> B. An enzyme
taurus [48]

Answer:

I think it's A) A protein substrate

8 0
2 years ago
Other questions:
  • Which of the following individuals will inherit an X-linked allele from a man who carries it?
    8·1 answer
  • Identify the longest, shortest, strongest, and weakest bonds from those highlighted below.
    13·2 answers
  • What is the most accurate description of b-vitamins?
    9·1 answer
  • What tissue provides structure to the bladder?
    10·1 answer
  • What enables you to bend and twist in science what<br> bone or joint
    7·1 answer
  • Touch sensations and proprioception are carried primarily along the:
    7·1 answer
  • SOMEONE PLEASE ANSWER!!! I need help with this question!!!
    7·1 answer
  • Mitosis is a part of interphase in the cell cycle. <br><br> true<br> false
    10·2 answers
  • Answer the bell ringer question..
    10·2 answers
  • Musashixjubeio0<br> What is the answer
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!