1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
3 years ago
15

What is the relationship between a consumer and photosynthesis?

Biology
1 answer:
amm18123 years ago
8 0

Answer:

Photosynthesis is the process by which green plants prepare their own food. They prepare their own food because they have chlorophyll in them.

Example: green plants like flowering plants, red algae, etc..

Consumers are the organisms that consume this food prepared by the plants. They cannot prepare food by itself. They don't have chlorophyll so they cannot prepare their own food.

Example: human, animals, plants that does not have chlorophyll, etc..

Hope this helps u

and have a great day ahead

:)

You might be interested in
Coal can be described as *
ycow [4]

Answer:

All of the above

Explanation:

U 2 can help me by marking as brainliest.......

8 0
3 years ago
Proteins do all of the following things in the body, except which of the following
Anon25 [30]
Please state the following :)
5 0
3 years ago
What is the difference between asexual and sexual reproduction?
dalvyx [7]
One is were you bang someone else to reproduce and the other is where you bang yourself to reproduce
7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which describes the foramen magnum?
stich3 [128]
The Foramen (Meaning Opening) Magnum (Meaning Large) is a large opening at the base of the skull that the spinal cord passes through to connect the lower body to the brain.  The Foramen Magnum is<span> one of the several foramina found in the base of the skull.</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • During assessment, a patient states, "i don't know why god is punishing me like this." which nursing diagnosis would the nurse m
    15·1 answer
  • Predators often control the population of their prey. If wolves are removed from a specific community, the population of moose i
    14·2 answers
  • Why can a cell not survive under conditions of unlimited growth
    13·1 answer
  • Which of the following values represents an index of refraction of an actual material?
    11·2 answers
  • The _____ , first proposed by ronald melzack and patrick wall, is a current explanation for how pain works
    5·1 answer
  • The graph presents information about the climate of Dallas, Texas.
    5·1 answer
  • What is the goal of the engineering lab? 2.04 Thermal Energy and Chemical Change
    6·1 answer
  • . When psychologists say that a given trait is due more to nature than nurture, they mean that the trait
    12·1 answer
  • What is the function of the cebtrosome and centioles in the cell during mitosis
    7·1 answer
  • 1Neurons are classified in several different ways. From the following statements, select which ones are true.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!