Answer:
All of the above
Explanation:
U 2 can help me by marking as brainliest.......
Please state the following :)
One is were you bang someone else to reproduce and the other is where you bang yourself to reproduce
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The Foramen (Meaning Opening) Magnum (Meaning Large) is a large opening at the base of the skull that the spinal cord passes through to connect the lower body to the brain. The Foramen Magnum is<span> one of the several foramina found in the base of the skull.</span>