1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lys-0071 [83]
3 years ago
10

How the flow of energy is different than the flow of chemicals?

Biology
1 answer:
viva [34]3 years ago
6 0

Answer:

Energy flow through ecosystems begins with producers. Chemical energy flow begins with consumers who obtain chemical energy by feeding on producers.

Explanation:

You might be interested in
What property do the following elements have in common? Sulfur, iodine, magnesium
Luba_88 [7]

Answer:

Same Phase at room temp

Explanation:

Here we have a metal and two nonmetals (sulfur and iodine).

They are all solid at room temperature. Metals form cations and are good conductors of electricity. They are not from the same family, therefore, they do not have the same number of valence electrons.

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A small piece of black paper was folded in half and use to cover part of the top and bottom portions of a leaf on the living ger
Hatshy [7]
Only the part of the leaf that was in the sunlight would contain starch because it absorbed light for photosynthesis however the plant that was covered was not able to absorb light because it was covered so no photosynthesis took place.
5 0
3 years ago
What things make studying people difficult
zavuch27 [327]
What makes studying people difficult is that you are yourself. You will always be different from other humans, so studying them naturally takes you out of your comfort zone
6 0
3 years ago
Researchers studying parental care in 20 female robins found that every female robin would place a recently collected worm into
IrinaVladis [17]

The correct answer is; the open mouth of a baby robin is seen as a sign stimulus for the female robin (parent), and that the open mouth is the impending cause for her behavior.

7 0
3 years ago
Read 2 more answers
Other questions:
  • All of the energy that drives earths Rock cycle comes from what
    14·2 answers
  • PLEASE HELP! Name one characteristic that all protists have in common that separates them from monerans.
    14·2 answers
  • 20.
    12·1 answer
  • List the 5 characteristics of life in order from smallest to largest
    15·1 answer
  • Question 1 of 10<br> 5 Points<br> What is the term for heat transfer because of direct contact?
    15·1 answer
  • The belly buttom is located on the ___ Surface
    8·1 answer
  • Science activity 1.4.2​
    8·2 answers
  • F1 is the symbol for...?
    8·1 answer
  • Choose True or False.
    9·2 answers
  • The two pathways fundamentally involved in the physiological response to stress are
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!