The genetic code is directly related to polypeptides and proteins in the sense that genes are decoded to synthesize proteins.
What is the genetic code?
Genetic code is the set of rules by which the sequence of bases in DNA are translated into the amino acid sequence of proteins.
The genetic code is unique for living organisms and is used to synthesize the proteins that is responsible for various activities in living organisms.
The genes in the genetic code are first transcribed into mRNA, which is then translated into proteins (polypeptides).
Learn more about genetic code at:
#SPJ12
Answer:
Hormones
Explanation:
Hormones travel through the body
Answer:
mRNA is “messenger” RNA. mRNA is synthesized in the nucleus using the nucleotide sequence of DNA as a template. This process requires nucleotide triphosphates as substrates and is catalyzed by the enzyme RNA polymerase II. The process of making mRNA from DNA is called transcription, and it occurs in the nucleus.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
This would actually be known to originate in the "nucleic acid". This would have nothing to do with the DNA it's self, and also protein has nothing to do with it also.<span>Nucleic Acid would be small particals in the cells that would consists of molecules would some sort of chain which would then lead to the DNA, but it would actually have not resemblance of the nucleic acid at any point.
</span>A Virus Is A Piece Of <span>Nucleic Acid</span> Enclosed In A Capsid.
