Answer:
Radiation exposure is a negative aspect.
Explanation:
Answer:
Explanation:
The arrangement below is from the smallest to the biggest
nucleotide → nucleus DNA → gene → chromosome → cell
The nucleotide is the smallest because it is what makes up the DNA, it is made up of a nitrogenous base, ribose sugar and a phosphate group.
Nucleus DNA follows because it is bigger than a nucleotide (as said earlier) but is singly found in the chromosome which is present in the nucleus.
The gene, which can be assumed to be the entire genome of the organism, involves both the chromosomal gene and the extrachromosomal gene (like the mitochondrial DNA).
Chromosome is made up of a DNA molecule and protein which makes it bigger than the Nucleus DNA and the gene because it contains several genes.
The Cell contains all the molecules/organelles mentioned above and as such is the largest among them all.
Note that the spellings the question are wrong and have been corrected in the answers provided
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Oxygen, carbon, and hydrogen.
Answer:
The process depicted in the diagram above is explained below in complete details.
Explanation:
1 asexual generation
2. cytokinesis
3. karyokinesis
4.fission
(a) Amoeba
(b) in repetitious fission many elements modifications to offspring ( plasmodium ( while in amoeba only individual sections to create two separate daughter cell
(c) asexual reproduction
ii in leishmania you can totally cut three sections and it changes to a new organism and in amoeba, it can be cut wherever.