1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
3 years ago
5

Identical, or monozygotic, twins develop from a single egg fertilized by a single sperm. Monozygotic twins are genetically ident

ical because they originate from a single zygote that split into two. Caroline Lost and her colleagues examined nine measures of social, behavioral, and cognitive ability in 1000 pairs of both male and female identical twins. Their study found that pairs of male twins tended to be more alike in their prosocial behavior, peer problems, and verbal ability scores than pairs of female twins. Which of the following choices explains this observation? s on the X and Y chromosomes in the brains of males results Interacting g in identical twins with more similar behaviors Identical male twins express the same X-linked alleles in their neural cells because males undergo random X-inactivation Male twins have similar expression levels of X-linked genes, because the Y chromosome silences expression of X chromosome genes Q Females are mosaic for the expression of heterozygous X-inked loci because females undergo random X-inactivation
Biology
1 answer:
tankabanditka [31]3 years ago
7 0

Answer:

The correct answer is "Females are mosaic for the expression of heterozygous X-inked loci because females undergo random X-inactivation".

Explanation:

This study reports that pairs of male twins tended to be more alike in their prosocial behavior, peer problems, and verbal ability scores than pairs of female twins. This is explained by the process of random X-inactivation in pairs of female twins. Random X-inactivation is the transcriptional silencing of one X chromosome in female cells during its development. This results in pairs of female twins being mosaic for the expression of heterozygous X-inked, making female twins actually not identical in its phenotype.

You might be interested in
Explain the specific mechanisms that have allowed for diversity in organisms
kirill115 [55]

There are five mechanisms involve in diversity of organisms:

genetic drift, mutation, natural selection, gene flow and non random mating.

Explanation:

Genetic drift: It is a mechanism in which frequency of the allele changes within a population due to random sampling. It causes decrease in diversity in organism and can result in new species.

Mutation: Mutation in the genes is the most important reason of diversity.the change in DNA causes introduction of new alleles. Harmful mutations do not le species evolve by delimiting them from reaching sexual maturity.

Gene flow: The allele flow happens when a new gene is introduced into a population either by immigration or random mating. when two populations of same species share genes, variation occurs.

Natural selection: The favourable traits for survival are transferred to the offspring. It allows them to adapt better to the environment.  It allows maintenance diversity of organism.

Non random mating: The mating between the individual with varied genotype will result in genetic variation.

8 0
3 years ago
3. Why is it that people living in poverty, who are often racial minorities, end up living in?
Virty [35]

Answer:

a lack of resources and stability can be a major factor for this situation, meaning they dont have much of a choice. they become a nuisance to richer clients and are therefore removed and dumped away.

5 0
1 year ago
The model shows how pimples are formed in the skin. Why do you think this process can occasionally lead to pain?
marishachu [46]

Answer:

The bacteria replication leads to swelling, which irritates nerves in the dermis Explanation:

so B is your answer

hope this helps you

6 0
3 years ago
Which is a function performed by the central nervous system (CNS)? Select all that apply.
Tema [17]

Answer:

the stimula is like nervs your body pumps it threw your body to

Explanation:

it is a common thing

8 0
4 years ago
If _________ accumulates around the teeth over a period of time, periodontal disease may result.​
Semmy [17]

Answer:

If <u>bacterial plague</u> (a.k.a. dental plague) accumulates around the teeth over a period of time, periodontal disease may result.

6 0
3 years ago
Other questions:
  • An atom that carries an electric charge is called a neutron.<br><br><br> True or false?
    10·1 answer
  • Assume all are homozygous. Alleles: A=agouti, C=chinchilla, a=albino, A is dominant over C and a, C is dominant over a.
    10·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Specific ways that a drug could increase the effect of a neurotransmitter (NT) at a synapse include: 1) causing the NT to leak o
    13·1 answer
  • Which of the following animals has a broad niche?
    6·1 answer
  • Why does Pakistan experience frequent earthquakes?
    9·2 answers
  • Which of the following bones is not part of the appendicular skeleton?
    9·1 answer
  • Helppppppppp pleaseeee
    12·2 answers
  • How are red blood cells and neurons different?
    5·1 answer
  • What is science to you?​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!