1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
What gives sperms motility​
Mandarinka [93]

Answer:

The tail of the sperm, the flagellum

Explanation:

We find cilia in the human body. They coat the epithelial cells of the upper respiratory tract and play a role in keeping dust particles, smog, and potentially harmful microorganisms from entering the lungs.

Their movements enable the movement of mucus or other substances across the surface of various epithelial cells. The cilia also cover parts of the male and female reproductive tract.  

Flagella are found in sperm, whose tail represents the flagellum in its structure. The body wall of the sponge, among others, contains cells with whips that create and maintain the flow of water through the body.

7 0
3 years ago
100 points! I will make you a brainlest Help me right now!!! With all questions (5,6,7)
OLga [1]

Answer:

show slide 4

Explanation:

3 0
2 years ago
How does mutation enable viruses to continue causing disease?
Hunter-Best [27]
Genetic Change in Viruses. Viruses are continuously changing as a result of genetic selection. They undergo subtle genetic changes through mutation and major genetic changes through recombination. Mutation occurs when an error is incorporated in the viral genome
3 0
2 years ago
Genetic alteration probably refers to altering what
puteri [66]
Genetic alteration refers to altering DNA sequence. Gene alteration forms genetically modified products that modifies the gene sequence. DNA consist of two long chains of nucleotides that are twisted and joined together in hydrogen bonds. These DNA cannot be altered in nature but gene expression can be altered.
6 0
3 years ago
How should you test a hypothesis?
timama [110]
A hypothesis should be tested by changing one variable in an experiment.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What are some characteristics of weight?
    14·2 answers
  • Zebras are classified as vertebrates because they have
    13·1 answer
  • on the planimetric map the ___ tells you the number of inches on the map for every actual mile that the map represents
    12·2 answers
  • In a population of owl monkeys, allele T codes for tufted tails ( TT and Tt). The
    8·1 answer
  • How does dr. Abooker hope to apply has work to human health
    7·1 answer
  • Which of the following are part of the protists kingdom?
    15·1 answer
  • The origin and evolution of viruses is controversial. Discuss whether you think viruses evolved before the first cell or whether
    11·1 answer
  • 9. Give an example of a trait and explain how a genetic trait is passed down from parent to offspring in
    7·1 answer
  • 2. Identify one simple machine used at your home and explain how it makes your work easier​
    12·2 answers
  • Gentoo penguins present a potential mate with a pebble. Emperor penguins have a specific call and movement that they make to att
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!