1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
Fungi are classified into how many groups?
d1i1m1o1n [39]
The answer would be D. Four groups

Fungi are usually classified in four divisions: the Chytridiomycota (chytrids), Zygomycota (bread molds), Ascomycota (yeasts and sac fungi), and the Basidiomycota (club fungi).
7 0
4 years ago
Read 2 more answers
Which of the following is likely a defense mechanism for a plant? a. A bold warning color c. Shedding leaves and petals b. A sha
lyudmila [28]
A sharp, stinging odor would most likely be a defense mechanism for a plant.
3 0
3 years ago
a heterozygous person has the same as phenotype as a person who is homozygous for the __________ allele
bekas [8.4K]

A person with a heterozygous genotype for a given trait will have the same phenotype as a person who is homozygous for the dominant allele.

5 0
3 years ago
From fossil evidence, you know two species shared a common ancestor approximately 50 million years ago. In comparing a known neu
MissTica

Answer:

Option c (2\times 10^{-9}) is the correct alternative.

Explanation:

Given:

Common ancestor,

= 50 million years ago

Base differences,

= 92

Now,

The predicted mutation rate will be:

= \frac{92}{50\times 10^6\times 1000}

= \frac{1.84}{10^9}

= 1.84\times 10^{-9}

or,

= 2\times 10^{-9}

Thus the above solution is the right one.

4 0
3 years ago
A change in the gene pool of a population due to chance is___.
vekshin1

Answer:

Genetic Drift.

Explanation:

Hope my answer has helped you!

4 0
4 years ago
Other questions:
  • How does the number of chromosomes in a female scorpions egg cells compare number of chromosomes in her body cells
    14·1 answer
  • 24.
    7·2 answers
  • How do photoautotrophs make energy?
    8·2 answers
  • Why was wegeners<br> hypothesis for continental drift rejected ?
    6·1 answer
  • Explain where photosynthesis takes place? What is the function of this organelle?
    9·1 answer
  • What does this sequence What does this sequence illustrate?
    9·2 answers
  • Someone please please help me with this !! (Includes the graph )
    12·1 answer
  • Which statement is true about the
    11·1 answer
  • Matias wanted to see if his dog would lose weight if he took the dog for a walk twice a day instead of just once a day. What is
    10·2 answers
  • Which type of gland produces hormones?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!