1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
What happens to the body when you have Down Syndrome? Please explain!
nalin [4]
As babies they may reach growth and development milestones later than other children do. These may include rolling over, sitting, standing, walking, and talking. As children in this age group, health problems and developmental disabilities can lead to behavior problems. For example, a child may develop oppositional defiant disorder which is a disorder in a child marked by defiant and disobedient behavior to authority figures. They may get this disorder because he or she does not communicate well or understand others' expectations. As teens puberty starts at about the same ages for teens with Down syndrome as for other teens. <span>They may face social difficulties and vulnerabilities <em /><em />such as abuse, injury, and other types of harm. They may also have a hard time handling strong emotions and feelings. Sometimes these struggles can lead to metal health problems, especially </span>depression which could lead to self-harm or even suicide. As adults men with Down syndrome most often are sterile and cannot father children. Many women with Down syndrome can have children, and they usually have early menopause which is <span>a natural decline in reproductive hormones when a woman reaches her 40s or 50s but in this case it would usually happen early in Down Syndrome women.

Hope this helps you out on your report is there anything else you want me too help you with? :)
</span>
5 0
3 years ago
Which liquid would be the most difficult to raise or lower the temperature of?
IRINA_888 [86]

Answer:

OD

Explanation:

Since it has a high heat capacitive it will be able to store much more energy and therefore will not be easy to raise or lower temperature

7 0
2 years ago
Which one is correct tho?
djverab [1.8K]

Answer:

is c

Explanation:

8 0
3 years ago
Read 2 more answers
Which is made up of lipids<br><br> a) steroids<br><br> b) peptides<br><br> c) prostaglandins
Mamont248 [21]
B because the peptides when they collect in a clump, has a effect like hydrocloric acid.
6 0
3 years ago
Which process helps gas exchange to occur?
zavuch27 [327]
Hello Pgoodrichstat!

The process that helps gas exchange occur is called diffusion.

Cheers!
-Blizzard
8 0
3 years ago
Read 2 more answers
Other questions:
  • I’m simple dominance, what is the result when a dominant allele pairs up with recessive allele
    13·1 answer
  • During interphase, the dna has replicated so the chromosomes that appear during prophase are actually doubled. the structure the
    10·1 answer
  • In the visual analogy of the growing town, what does the library represent? identify two characteristics that make it a good cho
    7·1 answer
  • Discuss some society issues regarding biotechnology.
    13·1 answer
  • Which abiotic factor in tropical forests do boreal forests lacks
    15·2 answers
  • Is a short, fleshy stem surrounded by enlarged, fleshy bases of leaves.
    7·1 answer
  • in a dihybird cross for round and yellow seeds (RrYy × RrYy), what is the probability of having green and wrinkled seeds ?
    11·2 answers
  • 01:04 An atom of carbon (C) forms covalent bonds with two atoms of axygen (O) to form carbon electrons of these atoms rearranged
    14·1 answer
  • If pore space comprises 60% of the total volume of a soil and half of this pore space is filled with water, how much of the tota
    13·1 answer
  • PLZ HELP ME!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!