1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
Which describes the chromosomes by the end of prophase II of meiosis?
Rama09 [41]
B because the diploids always line up in the middle on chromosomes
4 0
4 years ago
Read 2 more answers
The____ is the section of the rainforest that is too dark for most plant life.(write response, no opinion choices)
AveGali [126]

Answer:

Forest floor

Explanation:

Tropical rainforest is characterized by high rainfall that allows a diverse growth of plant species. The different species of plants and animals species that make up a rainforest are found in different layers. There are four layers or sections in the rainforest from top to bottom viz: emergent layer, canopy, understory and forest floor.

Since the layers are classified from top to bottom, each layer receives different amount of rainfall and sunlight. According to the question, the FOREST FLOOR receives the least amount of sunlight making it the darkest section of the rainforest. Due to the inhibited penetration of sunlight into this layer, it usually does not support any plant growth.

5 0
3 years ago
When two species occupy exactly the same niche, one species will be eliminated from the community by _____.
liubo4ka [24]

Answer:

Answer is B

Explanation:

Hope it helps

6 0
3 years ago
Most mammals have diploid body cells and haploid gametes. During __________, chromosomes from haploid gametes combine, and a ___
BigorU [14]

Answer:

C. or  fertilization, diploid

3 0
3 years ago
True or False. Water stayed in the straw activity we did because of water pressure.
Vanyuwa [196]

Answer:

2

Explanation:

because it being pressure

4 0
3 years ago
Read 2 more answers
Other questions:
  • A tiny rocky island in the South Pacific is home to a very small food chain. Coconut palms grow on the island and drop coconuts.
    9·1 answer
  • Why is cell division useful even in an adult who isn't even growing
    7·1 answer
  • Following meiosis the resulting gametes have ______ chromosomes
    6·1 answer
  • Just like farmers nature can select which variation of a trait, found on an organism, can live and reproduce. How does nature im
    11·1 answer
  • Which term describes the number of waves that pass a given point in a given time?
    15·2 answers
  • How, not what, were the four requirements for life identified by scientists?
    6·1 answer
  • 4. Compare a male to a female frog. How can you tell the difference?​
    15·2 answers
  • 2. What does letter B represent on the Earthquake model?
    14·1 answer
  • What's the hardest thing you've ever done? Did you benefit from it? Was it worth it?
    11·2 answers
  • Occurs in mitochondria.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!