1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
A marine biologist wants to investigate the effect of ocean tides on certain aquatic ecosystems. Can this be studied by the scie
lutik1710 [3]
Yes it can be studied by the scientific method because it is testable and observable.
6 0
3 years ago
Read 2 more answers
Differences between mono di and polysaccharides ​
timama [110]

Answer: monosaccharides are simple sugars made up of only a single sugar molecule. Disaccharides are sugars made up of two sugar molecules linked together by a glycosidic bond while polysaccharides are complex sugars made up of many sugar molecules linked together by glycosidic bonds.

Explanation: Examples of monosaccharides are glucose, fructose, and galactose, while examples of disaccharide sugars include maltose, lactose and sucrose. Examples of polysaccharides include glycogen

and starch.

7 0
3 years ago
The endoplasmic reticulum bound enzyme that hydrolyzes glucose-6-phosphate to glucose in liver is:________
Valentin [98]

The endoplasmic reticulum bound enzyme that hydrolyzes glucose-6-phosphate to glucose in liver is: glucose-6-phosphatase.

Glucose-6-phosphatase (G6Pase), an enzyme found mainly in the liver and the kidneys, plays the important role of providing glucose during starvation. Unlike most phosphatases acting on water-soluble compounds, it is a membrane-bound enzyme, being associated with the endoplasmic reticulum.

Liver cells contain a membrane bound enzyme called glucose-6-phosphatase for glycogenolysis by glucagon especially during starvation when free glucose is required. As glucagon enters the liver cells it activates the enzyme glucose-6-phosphatase which then acts on glucose-6-phosphate and hydrolyzes it. As glucose-6-phosphate is hydrolyzed, it results in the formation of a phosphate group and a free glucose. The free glucose thus formed is transported from the liver cell to other tissues by specific glucose transport membrane protiens.

Learn more about endoplasmic reticulum here:

brainly.com/question/13474354

#SPJ4

8 0
1 year ago
The __________ molecule is known as the universal energy source of the cell. *
EleoNora [17]

Answer:

The answer is ATP, however, NADH is part of what goes into producing ATP.

Happy holidays!

8 0
3 years ago
25.
laila [671]
The answer would be C as it can be directly tested experimentally and observed that bacteria adapted to become drug resistant and the natural selection of drug resistant bacteria to survive and continue proliferating, thus being direct evidence of evolution
4 0
3 years ago
Other questions:
  • The electron transport chain (ETC), or respiratory chain, is linked to proton movement and ATP synthesis. Select the statements
    15·1 answer
  • Anna waters her plants with salty water to help them grow better. Is her thinking correct?
    15·1 answer
  • What is the difference between refraction and reflection
    14·1 answer
  • Ingested dietary substances must cross cell membranes to be used by the body, a process known as Ingested dietary substances mus
    7·1 answer
  • Which repeating units make up proteins
    13·2 answers
  • A company develops a new antibiotic. When the antibiotic is first used, it kills nearly all the bacteria.
    8·1 answer
  • What stores digestive enzymes that break down lipids, carbohydrates, and proteins into small molecules that can be used by the r
    8·1 answer
  • How do invasive species travel?
    14·1 answer
  • Enzyme deficiencies that affect the fatty acid β-oxidation pathway are often diagnosed by examining the different metabolic inte
    9·1 answer
  • Which of the following is a likely geographic barrier for speciation of finches?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!