1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
The plant on the left is the parent plant. the plant on the right is the parent's offspring. the offspring is genetically identi
Aloiza [94]
The parent plant produced asexually because offspring from asexual reproduction are genetically identical to the parent.
7 0
3 years ago
Down syndrome, the most common genetic condition in the United States, is also called trisomy 21. What does this mean?
77julia77 [94]

Trisomy=3 chromosomes; 1 more than the required pair (2)

21=the type of chromosome

So, here we can eliminate A and B.

Now we have C and D.

I know that when sperm cell(s) simultaneously fertilize [an] egg, a class of identical twins will form. Therefore, we can eliminate D, leaving us with merely C. Henceforth, C is your final answer.

4 0
3 years ago
Read 2 more answers
The height of wind formed waves depends on what three things?
Ganezh [65]
The height wind waves or waves generated by the wind are surface waves that occur on the surface of oceans, lakes, rivers, seas and canals etc. Waves can travel thousands of miles before reaching land. They range in size from small ripples to over 100 foot high. They are dependent on the following three things:
1. Wind speed - the height of waves is dependent on the speed of the wind. The faster the wind, the higher the waves and vice versa. 2. Wind direction - the height of waves is dependent on  whether the wind is blowing offshore or onshore. Offshore winds blow from the land onto the sea so tend to cause bigger waves3. Storm winds in a cyclone or hurricane. These winds travel in circles around the eye of the storm and are usually very high in intensity. Depending on the intensity of the wind and the speed at which the wind is travelling, the wave height will differ. 



7 0
3 years ago
Which best describes what happens to a developing fetus during the third
Aleks [24]

Answer:

limbs form the baby has fingers, hands,arms, feet and toes. they can now open and close their fists and mouth

7 0
3 years ago
Read 2 more answers
According to biological classification, which of these pairs represents animals that are the MOST closely related? A) crabs and
Serggg [28]

Answer:

crabs and fish.................

5 0
3 years ago
Other questions:
  • What is a hypothesis?
    13·1 answer
  • Describe the structure and function of the nucleus and briefly explain how the nucleus controls protein synthesis in the cytopla
    13·1 answer
  • Which correctly shows the process of photosynthesis?
    10·1 answer
  • What is 18.194 rounded to?
    6·2 answers
  • What are the largest and most stable ecosystems on earth
    9·1 answer
  • Many mutations in receptor kinases that lead to cancer allow the dimerization and activation of the receptor, even in the absenc
    6·1 answer
  • Which of the following correctly arranges the planets by their orbital speeds from slowest to fastest?
    6·1 answer
  • The light reactions of photosynthesis use ____ and produce _____. A. NADPH; NADP* b. Water; NADPH & ATP c. Carbon Dioxide; s
    11·1 answer
  • How does cellulose function in living things?
    6·1 answer
  • Is there a difference between cell division and reproduction?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!