1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
Whta is fetilisation and what are the types of fertilisation
uysha [10]
The action or process of fertilizing an egg, female animal, or plant, involving the fusion of male and female gametes to form a zygote. The gametes that participate in fertilisation of plants are the sperm (male), and the egg cell, and in flowering plants a second fertilisation event involves another sperm cell and the central cell which is a second female gamete. In flowering plants there are two sperm from each pollen grain.
6 0
3 years ago
A widow of 6 months is brought to a psychiatric hospital. during the assessment interview the client avoids eye contact, respond
Rama09 [41]
<span>I think that the best initial approach to the client by the nurse would be to comfort and first assure the client that she's not there to hurt or harm the client in any way and that no one is judging (s)he and most important that this recommendation is only for the better and to help the client.</span>
4 0
3 years ago
Five students get sick with a cold after a weekend field trip to the aquarium with their classmates. Which best explains why the
SIZIF [17.4K]

Answer:

I'm not 100% sure but I think it either a or d

Explanation:

hope this helps

3 0
3 years ago
Read 2 more answers
What is the smallest size category of soil
Sergeeva-Olga [200]
B. Clay particles are the smallest
8 0
3 years ago
Read 2 more answers
Plants using the CAM pathway occur in many locations but are most common in very arid locations, such as deserts. What deserts o
Paladinen [302]

The desert that occurs in North America is the Great Basin Desert and it is located at Nevada of North America.

CAM pathway, which is also called Crassulacean Acid Metabolism, is a pathway that involves carbon fixation that occurs in plants growing in arid areas.

With this pathway these plants are able to photosynthesize during the day, but only exchange gases at night.

An arid habitat is an environment that is characterized by extreme lack of water, example is the desert.

In North America, the desert that occurs there is the Great Basin Desert. It spreads into different states which include:

  • Nevada
  • Western Utah,
  • Eastern California, and
  • Idaho.

But the major part of Nevada is occupied by the Great Basin Desert.

Learn more about CAM pathway here:

brainly.com/question/7061938

6 0
3 years ago
Other questions:
  • What would you expect to happen if your blood sugar was 120 mg / 100 mL?
    14·2 answers
  • Matthew is assigned a project to learn about cellular respiration. He discovers that the Krebs cycle is a ____________ process w
    8·1 answer
  • Which is the planet that is most similar to earth
    13·1 answer
  • Which accurately describes the relationship between cancer risk and exposure to mutagens?
    15·2 answers
  • Patient A got IV fluid at the hospital that turned to be water. what would happen to the patient's blood cells.
    15·1 answer
  • A view of attention-deficit/hyperactivity disorder (ADHD) that focuses on the neurobiological component of the disorder cites ev
    12·1 answer
  • What's More
    5·1 answer
  • Why does the the right testicle hang lower than the left?? PLease help i will be thank (Sorry english second language if your wo
    11·1 answer
  • Which phase of cell division is shown?
    13·2 answers
  • DNA and Rna are macromolecules made up of what?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!