1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
How does someone become a carrier for sickle cell anemia?
patriot [66]

Answer: A !

Explanation:

8 0
3 years ago
Match these objects with their best description.
Y_Kistochka [10]

Answer:

Jupiter - Giant red spot

Mars - Most habitable other than earth

Mercury - Smallest terrestrial planet

Pluto - Is a Kupiter belt object

Saturn - Most visible rings

6 0
3 years ago
A gas is heated and its temperature increases. What happens to the gas molecules?
Gre4nikov [31]

D.They increase on number

5 0
3 years ago
Read 2 more answers
8.The advantage of light microscope over electrons microscope:
Dafna1 [17]

Answer:

may be D is the right answer because

electrons microscope it not easy to handle and so expensive but light microscope is easy to handle and less experience

4 0
3 years ago
Read 2 more answers
_________ are not open to viewers and are for alcoholics having a serious desire to completely stop drinking. question 11 option
pogonyaev
Closed meetings are not open to viewers and are for alcoholics having a serious desire to completely stop drinking. These meetings are for alcoholics Anonymous members only, consisting of men and women who share their experience, hope and strength with each other that they may solve their common problem and help others to recover from alcoholism. Therefore, the requirement is the desire to stop drinking. 
4 0
4 years ago
Other questions:
  • Answer the question please
    10·1 answer
  • How many stars are at the center of our solar system?
    14·2 answers
  • Cherry cells have 32 chromosomes. how many chromosomes do each of the daughter cells produced by mitosis have?
    6·2 answers
  • Stroke volume is the amount of blood that leaves the left ventricle of the heart with each contraction. If a person has a stroke
    13·1 answer
  • Please help with this question it is in the attachment below
    14·1 answer
  • What cannot be determined by observing an individual
    13·1 answer
  • Darwin explained that all life came from ________________
    8·1 answer
  • HELPPP!! QUICKK!!!
    8·1 answer
  • PLSSSSS HELPPP PLS HELP HELP
    10·1 answer
  • Which is not a method used to detect extrasolar planets? a. transit photometry b. radial velocity measurements c. direct imaging
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!