1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
An example of a parallel choice on a dichotomous key is
Misha Larkins [42]
An example of a parallel choice on a dichotomous key is happy or sad and old or young. Either one of those answers.
7 0
3 years ago
Read 2 more answers
Some geneticists study the genes that control bone development to try to understand bone growth and find cures for diseases. How
AnnZ [28]

Options:

a) the geneticist looks at the symptoms of a disease, and the orthopedist does not.

b) the geneticist works in a hospital, and the orthopedist works in a lab.

c) the geneticist focuses on what causes the disease, and the orthopedist treats the disease.

d) the geneticist deals with patients, and the orthopedist does not.

Answer:

The geneticist focuses on what causes the disease, and the orthopedist treats the disease. so thats why different from an orthopedist (a doctor who specializes in bones). Thus, the correct option is C.

<h3>What is chromosomes?</h3>

A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's genetic code. Histones, which serve as packing proteins for the majority of eukaryotic chromosomes, work with chaperone proteins to attach to and condense the DNA molecule in order to preserve the integrity of the molecule.

A medical geneticist specializes in using DNA tests and genetic data to identify, manage, or prevent chromosome problems, inherited genetic illnesses, and other genetically driven diseases and ailments.

Orthopedic physicians, often known as orthopedic surgeons, concentrate on assisting you with musculoskeletal problems. They are responsible for identifying and managing diseases that impact your musculoskeletal system.

For more information regarding chromosomes, visit:

brainly.com/question/11912112

#SPJ1

6 0
2 years ago
A scientist is tracking an object orbiting the Sun that is found between Mars and Jupiter. Which additional feature can
larisa86 [58]

Answer:

The correct answer is actually B. Has an irregular shape.

5 0
3 years ago
Which of the following is not required by animals to control body temperature?
Airida [17]

your answer is B. because An animal must do three things to control body temperature. First, the animal must find a source of heat. Second, it must find a way to conserve heat when temperatures in the environment are too cold. Third, it must find a way to get rid of extra heat when temperatures in the environment are too hot.

5 0
3 years ago
Trace fossils can provide which type of evidence? Evidence that animals were never in that area. Evidence that animals were at s
ella [17]
Trace fossils represent things that were alive, it could be footprints, or bones.

I think this option fits best:

"<span>Evidence that animals were at some time in the area."</span>
7 0
3 years ago
Other questions:
  • All wetlands are considered freshwater ecosystems.   Please select the best answer from the choices provided T F
    9·1 answer
  • I need help with 5 vocabulary questions of Biology. I can only show one at a time.
    14·1 answer
  • Anna waters her plants with salty water to help them grow better. Is her thinking correct?
    13·1 answer
  • In the microscope activity, you viewed some of the same specimens under multiple microscopes. Describe the differences in what y
    6·2 answers
  • Which of the following STATEMENTS is/are false? (Select all that applies) A.)Energy can be transformed to a different form of en
    6·1 answer
  • Anaerobic respiration produces a maximum of ______ ATP per glucose.
    11·1 answer
  • __________________ are the first organisms to live in an uninhabited area.
    5·2 answers
  • 1. State the role of speech and writing in human life
    10·1 answer
  • What is the main characteristic of love?
    10·1 answer
  • If you placed the celery into a bottle of colored water that was 35% sugar, would the colored water be seen in the celery? Why o
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!