1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
_______ is (are) associated with permafrost
Pavlova-9 [17]
<span>High latitudes and altitudes are associated with permafrost. These areas provide the lengthy cold conditions that support permafrost development. Permafrost is soil, rock or sediment that is frozen for more than two consecutive years and is not found in warmer climates.</span>
6 0
3 years ago
Why is nitrogen so important to plants
Pachacha [2.7K]
Nitrogen is so vital because it is a major component of chlorophyll, the compound by which plants use sunlight energy to produce sugars from water and carbon dioxide (i.e., photosynthesis). It is also a major component of amino acids, the building blocks of proteins.
3 0
3 years ago
Read 2 more answers
Fermentation is anerobic respiration he germination of yeast normally yields
mestny [16]
Fermentation yields ethanol and Carbon dioxide
3 0
4 years ago
Which type of organism is described by the functions listed below?
ch4aika [34]
The type of organism that is described above would be producers or the plants. They could provide habitat to animals and even to humans. They are the ones who produce oxygen for us to breath by the process of photosynthesis where they take in carbon dioxide from the atmosphere.
7 0
3 years ago
He use of the isotope 32p as a tracer element in the study of invasion and lysis of bacteria by viruses has shown that
alexira [117]
The use of the isotope 32P as a tracer element in the study of invasion and lysis of bacteria by viruses has shown that bacteriophage protein enters the bacteria. 
Phosphorus-32 is a radioactive isotope of phosphorus, such that the nucleus of phosphorous-32 contains 15 protons and 17 neutrons, one more neutron than the most common isotope of phosphorous, phosphorous-31.


3 0
3 years ago
Other questions:
  • What stage of cellular respiration use the high-energy electrons from NADH and FADH2 to form ATP molecules
    13·1 answer
  • Atom to elements concept map (plz help and thx)
    15·1 answer
  • How does the sun compare to the other stars on the main sequence
    5·1 answer
  • 2 examples of precise, measurable evidence of how human activities are having a profound influence on the global climate in term
    14·1 answer
  • What helps the cell get rid of the waste material?
    15·2 answers
  • Which factor would increase population size?
    15·1 answer
  • Why are fracking liquid waste pools harmful to the environment?
    13·1 answer
  • Which of the following living things would occupy the highest trophic level?
    6·1 answer
  • Helppppp will mark brainliest!!!!!
    12·2 answers
  • When igneous rock is formed,the size of the rock crystals or grains is primarily dependent on
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!