1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rashid [163]
3 years ago
6

Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

Biology
1 answer:
coldgirl [10]3 years ago
4 0

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

You might be interested in
Describe the pros and cons of the treatments used for each of the sickle cell anemia patients investigated in this activity.
notka56 [123]
Sickle cell anemia is caused by an abnormal hemoglobin in red blood cells. hemoglobin is the red pigment found in red blood cells for carrying oxygen.The abnormality arises from a genetic mutation in the DNA gene that codes for the  beta chain of the protein called globin of which hemoglobin is made of.In the beta chain, the sixth amino acid called glutamine is replaced by another one called valine.<span>This one change in the amino acids cause the hemoglobin protein  to behave abnormally, causing  red blood cells to lose their normal spherical shape and become bent like a sickle, hence the name "sickle cell" anemia</span>
5 0
3 years ago
You need to collect data to determine weather your biome works and your cactus will stay healthy. Determine the types of data yo
Sauron [17]

Answer:

Temperature, moisture, and precipitation. Use online sources to find averages for these stats

Explanation:

8 0
3 years ago
Read 2 more answers
The greenhouse effect plays a major role in the climate of a planet. Visit the Greenhouse Effect AstroTour, and use what you lea
Lesechka [4]

B. If there were no greenhouse effect, liquid water would not exist on the surface of the Earth

D. The Earth has reached thermal equilibrium, emitting the same amount of energy into space as it absorbs from the Sun.

E. The more carbon dioxide there is in an atmosphere, the stronger the greenhouse effect will be

Explanation:

The greenhouse effect plays major role in the climate of our planet in diverse ways:

  • it is responsible for the existence of liquid water on the surface of the earth.
  • it allows the earth to reach an equilibrium with space in exchange of thermal energy.
  • carbon dioxide concentration in the atmosphere has huge roles.

The greenhouse effects results from the abundance of greenhouse gases in the atmosphere. These gases are able to prevent long wave solar radiation from leaving the surface of the earth. When the gases interacts with the radiation, it produces heat that warms the earth surface. Examples of these gases are carbon dioxide, methane, water vapor e.t.c.

The warming of the surface helps to free freshwater trapped as ice and keeps it in the liquid form throughout.

In this exchange of energy, there is a balance between the amount of heat absorbed and radiated back into the atmosphere. As energy enters the earth, it is also radiated out into space. This helps to keep the earth temperature in balance.

Learn more:

Greenhouse emission brainly.com/question/4580761

#learnwithBrainly

7 0
3 years ago
According to natural selection, birds such as cardinals , eagles, and ducks have differently shaped feet due to
expeople1 [14]
The natural selection is the survival of the fittest, which means that o<span>nly the best adapted individuals survive and reproduce, contributing the most to the next generation</span>
According to natural selection, birds such as cardinals , eagles, and ducks have differently shaped feet due to <span>adaptation to different environments and feeding habits.
</span>
5 0
3 years ago
Select the correct answer.
Anna11 [10]

Answer: C

Explanation:

5 0
3 years ago
Other questions:
  • Write the dna complementary strand for GGCATTCGCGATCATG
    14·1 answer
  • Question 9 of 10
    8·2 answers
  • If we have a plate that has 2500 colonies on it, can we use this plate to calculate CFU's
    11·1 answer
  • Which of the following areas will most likely have the least surface run-off
    6·1 answer
  • Organisms are discovered to be living in a deep-sea trench. They are most likely _____. a) eukaryotes b) viruses c) archaeabacte
    8·1 answer
  • 6.) Water is essential to all living things. Discuss THREE properties of water
    9·2 answers
  • What is purpose of cellular respiration.
    6·2 answers
  • Where does the carbon comes from that makes up the glucose molecule?
    9·1 answer
  • 1 State whether the following statements are True or False.
    5·1 answer
  • EFFECTS OF NUTRIENTS (IN FOOD) ON THE STRUCTURE AND FUNCTION OF THE NERVOUS SYSTEM: UPDATE ON DIETARY REQUIREMENTS FOR BRAIN. PA
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!