Answer:
eveything that has organic material has cells, for example, rocks have molecules not cells
Explanation:
Answer:
In humans, blood group is determined by three alleles 
, 
, and 
.
and are co-dominant whereas is recessive to other two.
Thus, if a person with blood group O produces offspring with blood group B then the other parent must contain allele.
The genotype of other person can be 
, 
, or 
.
There is only one condition in which the person can have offspring with blood group O that is, when the other parent is .
In this condition, the probability of an offspring to have blood group O is 50%.
In other conditions, the probability of an offspring to have blood O is 0%.
Answer:
It is difficult to eliminate a recessive allele that expresses a detrimental trait because the carriers are usually asymptomatic & the disease is not phenotypically expressed until it is present as a homozygous pair.
This has been one of the many challenges of Eugenics.
Explanation:
Answer:
TTAACGCTAGCGAGCATGGCC
Explanation:
A and T pair together, and G and C are pairs. Whenever you see one of them in the original sequence, you'd just write the other one for the complementary sequence.
Answer:
Mutualism is the interaction between two or more organisms where both organisms can benefit from the interaction. ... Parasitism is the interaction between two species where only one benefits from the other organism and the other is harmed in return.
