1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
13

The cheetah is the fastest land animal accelerating from 0 to 100 km per hour in hour many seconds? 1) 2 seconds 2) 3 seconds 3)

5 seconds 4) 7seconds
Biology
1 answer:
Goryan [66]3 years ago
7 0

Answer:

I think under 6 seconds

You might be interested in
Psychology is considered a science because it uses a systematic method of asking and answering questions.
tekilochka [14]
This is true - psychology measures observable behaviours and used scientific methods
4 0
4 years ago
Read 2 more answers
Which of the following statements about chromosomes is true?
SashulF [63]

Answer: different organisms have different chromosome numbers

Explanation: eukaryote cells have more than one chromosome

chromosomes are present in most cells all the time (not in erythrocytes), but cannot be visualised except during telophase of mitosis or meisosis

bacterial cells don’t have a nucleus

7 0
3 years ago
While the bones of this joint may fracture, they rarely become dislocated. The articular capsule and accessory ligaments of this
nignag [31]

Answer:

Hip joint

Explanation:

Coxofemoral joint or hip joint. This joint joins the femoral head with the cotyloid cavity of the iliac or coxal bone. Together with the sacrum and the coccyx, both iliacs form a bony waist called the pelvis.

Joint capsule: It is a fibrous cuff that is inserted into the bone perimeter of the cotyloid cavity and the neck of the femur. The capsule is upholstered by a synovial.

Iliofemoral or Bertín: It is inserted in the anterior inferior iliac spine. It is directed downwards through two upper or iliopretrochanteric F.s: it is inserted in front of the facsimiles: F. lower trochanter major or iliopretrochanteric: it is inserted in front of the smaller trochanter.

Pubofemoral: It is inserted into iliopectine eminence, it ends in retrocantineal depression.

Ischio-femoral: It is located on the back of the joint. It originates in the subcotiloid canal and in the periarticular impeller. It ends on the inner side of the greater trochanter (in front of the digital pit).

- Round ligament

- Capsuar ligament.

Round ligament: Measures 3 cm long. It is intraarticular. It extends from the femoral head to the ischiopubial recess of the iliac. It has three fascicles Anterior ends at the anterior end of the recess. Medium ends in the transverse ligament of the Posterior acetabulum passes under the transverse ligament and joins the bone outside the notch.

The round ligament has an artery inside it that supplies the head of the femur. This artery is the branch of the obturator artery. The bottom of the acetabulum, head of the thorn femurllion of the ischium, iliac spine is removed.

8 0
4 years ago
What distinguishes surface and body seismic waves?
siniylev [52]
Answer:
Seismic waves are the wave form of energy that travels through the earth’s layer and they are produced as a result of earthquake, magma movement, volcanic eruptions, land slides and large man- made explosions.
There are two types of seismic waves: body waves and surface waves. Body waves travel through the interiors of the earth. Surface waves travels only through the interface between earth and the atmosphere.
Explanation: please look at comments for a explanation. It’s not letting me explain here.
5 0
3 years ago
Are there living organisms without cells
kkurt [141]
All living organisms are composed of one or more cells, per the cell theory.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Katie put a flowering plant on her kitchen table. How would the flowers respond to light coming through the window?
    6·2 answers
  • ____resemble grasses. Their leaves are not branched but rather parallel.<br> A.Dicots<br> B.Monocots
    9·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How many miles does someone run in an 8km race?
    5·1 answer
  • the only people with Rh negative blood are people who have inherited two recessive alleles for this trait. But some people who a
    12·1 answer
  • DOY CORONA SI ME AYUDAN PLSS<br> que fases de la mitosis de observan en la imagen.
    10·1 answer
  • Look at the food web shown above.<br><br> Which organisms get energy from consumers?
    15·1 answer
  • 1. Which weather variable can be determined by using a psychrometer?
    5·1 answer
  • The DNA is copied during which one of the following? (A) the mitotic phase (B) the G phase
    5·1 answer
  • PLEASE HELP IVE BEEN ON THIS QUESTION FOR 30 mins
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!