1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lilavasa [31]
3 years ago
15

What theroy of matter states that all particles of matter are inn constant motion?

Biology
1 answer:
Marrrta [24]3 years ago
3 0
I believe the answer is the kinetic theory of matter.
You might be interested in
The primary purpose of the basic economic order quantity model is
AleksAgata [21]

Answer:

D. to minimize the sum of setup cost and holding cost e. to calculate the optimum safety stock

Explanation:

Economic order quantity ( EOQ ) is formulated as :

EOQ= \sqrt[]{\frac{2C_O D}{C_h} }

Co = Ordering cost

D = annual demand

Ch = Annual unit holding cost

Economic quantity is the order quantity which minimizes sum of annual cost of ordering and annual inventory holding cost  so to minimize the overall cost of the inventory.

ANSWER : d) to minimize the sum of setup cost and holding cost that is to calculate the optimum safety stock.

6 0
3 years ago
What is the definition for Allele?
Bumek [7]

Explanation:

One of a number of alternative forms of the same gene occupying a given position, or locus, on a chromosome is allele.

5 0
3 years ago
Read 2 more answers
What is the human female reproductive system is adapted for? A. Production of zygotes in ovaries B. External fertilization of ga
victus00 [196]

Answer:

D. Transport of oxygen through a placenta to a fetus.

Explanation:

Zygotes are fertilized egg cell, zygotes aren't produced in the ovaries but ovums or egg cells are produced in the ovaries. So option A is false.

Fertilization is internal not external in human. Option B is wrong.

Production of milk happens in the mammary gland (the breast) not in the reproductive system. Option C is false.

Transport of oxygen through a placenta to a fetus. The placenta is a vascular organ which is implanted in the wall of the uterus (a part of the female reproductive system) and links to the foetus through the umbilical cord.

8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
__________ are waxy substances that circulate in the blood.
artcher [175]
Cholesterol is a waxy substance found in blood.
6 0
2 years ago
Other questions:
  • Which property is generally characteristic of metallic elements?
    8·1 answer
  • At what age do infants, start relying on others for signal about acceptable behavior, begin to show compliance to caregivers dem
    11·1 answer
  • Which of the following best describes the relationship between a mutation and a resulting change in the eye color of a rabbit
    5·2 answers
  • On the map, whichs symbol represents a cold front? Choose the correct letter
    9·2 answers
  • Which statement indicates that the patient who is taking an adrenergic-blocking drug understands the importance of avoiding othe
    5·1 answer
  • Describe phytoplankton
    6·1 answer
  • Which of the following is the best reason that trees are important for overall air quality?
    14·1 answer
  • What percentage of cancer deaths are related to smoking? 20% 40% 30% 50%?
    10·1 answer
  • Is there an advantage for the different
    7·1 answer
  • If we could represent what is going on inside a plant using a simulation:
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!