1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
joja [24]
3 years ago
7

Infectious agents could be organisms or viruses. You observe a case of conjunctivitis. Thisillness could be caused by an organis

m (Chlamydia trachomatis) or by Adenovirus.Both of these etiologic agents are obligate intracellular pathogens. Explain why one is a virus the other one is not by applying the criteria suggested by AndreLwof . Discuss how the two pathogens differ at each point covered in le
Biology
1 answer:
alexira [117]3 years ago
3 0

Answer:

Explanation:

Conjunctivitis can be caused by either a bacteria or a virus or even sometimes due to allergic reactions.

According to Andrelwof, viruses are classified based

i. on nature of DNA or RNA,

ii. nature of nucleocapsid ,

iii. symmetry of nucleocapsid,

iv. diameter of nucleocapsid with helical symmetry

So Chlamydia trachomatis is a bacteria, they have a nucleocapsid. They are just a single cell. But Adenovirus is a virus, that has a head and tail, contains nucleocapsid.

Chlamydia is Gram negative obligate intracellular pathogen. They can spread through direct or indirect contact through fomites, hand, contaminated towels. They affect both the eyes and symptoms include itching, irritation, discharge, swelling of eyelids, photophobia, and pain.

Laboratory diagnosis can be done by direct detection of inclusion bodies with Giemsa staining of conjunctival smears.

Adenoviruses are the most important and most frequent cause of follicular epidemic keratoconjunctivitis . The major mode of transmission is by direct inoculation by fingers. symptoms include itching, tearing, burning and foreign body sensation as well as photophobia.

the best method for diagnosis is the quantitative real-time polymerase chain reaction (PCR) and Enzyme immunoassays which are a cheaper and faster option with a high sensitivity.

You might be interested in
Which molecule is a product of the urea cycle and an intermediate of the citric acid cycle?
crimeas [40]
The urea cycle also known as the o r n i t h i n e cycle is a cycle of biochemical reactions that produces you re a from ammonia this cycle occurs in u r e o t e l i c organisms
5 0
4 years ago
Which process could occur in maple trees to decrease the chromosome number in pollen cells from 52 down to 26?
andrew11 [14]

Answer:

Meiosis

Explanation:

In a process of meiosis a sing cell divides twice to produce four daughter cells which contains half the amount of. genetic information These cells are sex cells. These four daughter cells consists of half the number of chromosomes of the parent so they are haploid. This is the reason in maple tree the chromosome decreased from 52 to 26.

4 0
3 years ago
As energy is transferred among organisms, some escapes from the environment as ___ energy
VARVARA [1.3K]
Thermal energy or heat is the energy released often as a waste but allows our bodies to stay warm
3 0
3 years ago
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
Chromosome 11 is made of over ( )million base
Natalka [10]

Answer:

Chromosome 11 is made of over

⇒ 130 million base pairs.

Approximately  ⇒ 2000 genes are found on chromosome 11

7 0
3 years ago
Other questions:
  • Carbon is the basis of all life and is constantly being cycled through ecosystems. In which form is carbon passed along from pla
    8·2 answers
  • Making rough estimates of physical quantities is useful so that
    6·1 answer
  • For example, oxygen (O₂) diffuses from the air sacs into the capillaries of the lungs because there is a ____________ concentrat
    9·1 answer
  • Neurotransmitters are secreted into a specialized junction known as the:
    13·1 answer
  • 7. Glacial eroded and deposited sediments.
    6·1 answer
  • 2 Points
    13·1 answer
  • In corn, small pollen (sp) is recessive to normal pollen (sp+) and banded necrotic tissue, called zebra necrotic (zn), s ssive t
    11·1 answer
  • Animals cells use a process called___ in order to convert ____ and _____ into ____ and ___. This process mainly occurs in the __
    7·1 answer
  • Sea turtles, mosquitoes, and frogs all show a
    6·1 answer
  • You're interested in knowing what percent of all households in a large city have a single woman as the head of the household. To
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!