Which of the following materials is not part of every chemical reaction?

Biology

2 answers:

Sladkaya [172]3 years ago

6 0

Answer:

The correct answer is C. gases.

Chemical reaction is the process by which one or more substances are converted into different substance or substances.

The substances which undergo chemical reaction are called as reactants while the substances which are produced by the reaction are called as products. During chemical reaction, chemical bonds of substrates undergo breaking and formation process to form an entire new product which may have same or different physical and chemical properties as compared to substrates.

Energy is either used or released during the chemical reaction. When the energy is used, it is termed as endothermic reaction but when the energy is produced by the reaction, it is termed as exothermic reaction.

Lastly, gases may or may not participate in a chemical reaction.

Rashid [163]3 years ago

4 0

<span>The correct answer is c. Gases are not needed to create a chemical reaction, whereas reactants, products and energy very much are.</span>

You might be interested in

What is an inducable enzyme

Sonbull [250]

Answer:

An adaptive enzyme or inducible enzyme is an enzyme that is expressed only under conditions in which it is clear of adaptive value, as opposed to a constitutive enzyme which is produced all the time. The Inducible enzyme is used for the breaking-down of things in the cell.

3 0

3 years ago

Timothy was born without testes. With respect to hormone production and sexual behavior, which of the following is the most like

kodGreya [7K]

Answer is D. Timothy will lack testosterone and will probably be unable to achieve an erection

3 0

3 years ago

he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the

Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0

3 years ago

Is during mitosis when the cell is most vulnerable

Harrizon [31]

I believe it is the red blood or platelets cell since white blood cells are trying to defend themselves

6 0

3 years ago

An ecosystem can sometimes repair itself from natural pollution. True or false

tresset_1 [31]

This answer is true.
Please rate brainliest answer!

4 0

4 years ago

Read 2 more answers