1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Karo-lina-s [1.5K]
4 years ago
6

In the dry and hilly region of southeast Utah, many fossil remains have been uncovered. Trilobite casts, petrified bones of alli

gators, and preserved dinosaur footprints, were all found in the same location, but in different rock layers. What can we infer about the history of this region?
options:

A: this area was a gathering place for many many different types of animals.

B: ancient flooding in this region washed fossil remains into this area.

C: the Earth’s surface and climate has changed over time.

D: this region has always had hot, dry climates.
Biology
1 answer:
Anastaziya [24]4 years ago
7 0
It is B for a matter of fact
You might be interested in
If there was no glucose available for plant and animal cells what would happen?
joja [24]

Answer:

Glucose is a sugar that many plants, animals and fungi use for energy. In plants, glucose is produced as a result of photosynthesis. Plants need the energy glucose provides in order to grow and reproduce. ... Without glucose, plants would not have the energy necessary to grow, reproduce or carry out cellular respiration.

Explanation:

UwU Hope I helped

4 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Cultures of a bacterial strain were incubated in a standard incubator, in an anaerobic jar, and in a candle jar. After incubatio
victus00 [196]

Answer:

Facultative anaerobe

Explanation:

A facultative anaerobe is an organism that commonly grow in the presence of oxygen and use aerobic process to form ATP and to gain energy but they can also grow in the anaerobic condition by getting energy from fermentation process.

As anaerobic condition is not the perfect condition in which facultative anaerobe wants to grow because they prefer more to grow in aerobic conditions, therefore, their growth is not that much high in anaerobic condition as compared to aerobic conditions.  

Therefore they show moderate growth in the culture present in candle jar and anaerobic jar because oxygen is absent there but show heavy growth in the culture present in a standard incubator because of the presence of aerobic condition here.

6 0
3 years ago
Millets have higher nutritional content than wheat and rice, so they are poised to make a comeback. Find out:
34kurt

Answer:

(a) The grains which are termed as millets are Amaranth, Barnyard, buckwheat, kodu, sorghum, bajra, Kangani, and Ragi.

(b) The following are the advantages of millet due to which they are given more preference than wheat and rice:

1. Millet's are free of gluten, a protein digestion of which is very difficult by the body.

2. When we compare the protein content of rice, wheat and millet, it is found that millet has high protein content.

3. In all aspects of components of nutrients called as carbohydrates, proteins, fats, minerals and vitamins, millet is in prime position and is also easy to digest.

3 0
4 years ago
How does the greenhouse effect affect climate change
exis [7]

Earth's temperature depends on the balance between energy entering and leaving the planet’s system. When incoming energy from the sun is absorbed by the Earth system, Earth warms. When the sun’s energy is reflected back into space, Earth avoids warming. When absorbed energy is released back into space, Earth cools. Many factors, both natural and human, can cause changes in Earth’s energy balance, including:

<span><span>Variations in the sun's energy reaching Earth</span><span>Changes in the reflectivity of Earth’s atmosphere and surface</span><span>Changes in the greenhouse effect, which affects the amount of heat retained by Earth’s atmosphere</span></span>

These factors have caused Earth’s climate to change many times.

Scientists have pieced together a record of Earth’s climate, dating back hundreds of thousands of years (and, in some cases, millions or hundreds of millions of years), by analyzing a number of indirect measures of climate such as ice cores, tree rings, glacier lengths, pollen remains, and ocean sediments, and by studying changes in Earth’s orbit around the sun.

This record shows that the climate system varies naturally over a wide range of time scales. In general, climate changes prior to the Industrial Revolution in the 1700's can be explained by natural causes, such as changes in solar energy, volcanic eruptions, and natural changes in greenhouse gas (GHG) concentrations.

Recent climate changes, however, cannot be explained by natural causes alone. Research indicates that natural causes do not explain most observed warming, especially warming since the mid-20thcentury. Rather, it is extremely likely that human activities have been the dominant cause of that warming. Hope i was helpful.

8 0
3 years ago
Other questions:
  • Which of the following observations demonstrates that living systems follow the law of conservation of mass?
    12·2 answers
  • What kinds of molecules have been found on extraterrestrial meteors?
    8·1 answer
  • 12. A dog pants because a. evaporation causes cooling b. evaporation gets rid of excess water in the body c. it is tired d. pant
    11·1 answer
  • What function does the nose serve in the respiratory system?
    10·2 answers
  • Which best describes a primary succession
    11·1 answer
  • If you don't like a certain food you could hide much of the taste by closing your eyes, holding your nose, pinching your skin, a
    14·1 answer
  • Without the natural filtration system of a wetland, money would most likely be spent on
    5·1 answer
  • Which of the following is a biotic factor in an ecosystem?
    14·1 answer
  • How does the human immune system initially respond to a pathogen?
    9·1 answer
  • quizlet chromosomes are composed of: please choose the correct answer from the following choices, and then select the submit ans
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!