1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cluponka [151]
3 years ago
15

Reciprocal altruism can be best explained with a model proposed by Robert Trivers in 1971. Trivers hypothesized that if one indi

vidual (A) pays some cost to help another individual (B), but the cost is recovered at some point in the future (when B helps A), then natural selection might favor behaviors that lead to this type of reciprocity. In which of the following situations is reciprocal altruism likely to occur?
Biology
1 answer:
Leni [432]3 years ago
6 0

Answer:

Reciprocal altruism is one of the altruism behaviors in which an individual organism helps in increasing the fitness of another organism by reducing the fitness of itself temporarily in expectation of the same behavior from another organism in the future later.

It takes place in the same set of organism partners which is a continuous interaction ion in stable groups of organisms.

Thus, the correct answer would be - an ongoing interaction in the same set of partners.

You might be interested in
Which parts of the cell membrane would help a large carbohydrate molecule enter the cell
Semmy [17]

Globular proteins im pretty sure

4 0
3 years ago
Read 2 more answers
Which molecule transfers carbon from animals to plants?
Tresset [83]
B oxygen is the answer
7 0
3 years ago
Read 2 more answers
Dna is located in a non membrane bound region in a prokaryotic cell called the
Over [174]
This would be the nucleiod region.
8 0
3 years ago
What is the color of stars with the highest surface temperature
stiks02 [169]
The answer is red for the highest surface temp of a star.
7 0
3 years ago
Read 2 more answers
What steps had to be taken before the building could be built?
Wewaii [24]

Answer:

You will have to Create a Detailed Plan

4 0
3 years ago
Other questions:
  • Limestone is an example of _____.
    15·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following is NOT an important source of resistance to blood flow? Which of the following is NOT an important source
    13·1 answer
  • The mental process of actively and skillfully conceptualizing, applying, analyzing, synthesizing, and evaluating information to
    10·1 answer
  • What are tectonic plates
    13·1 answer
  • WILL MARK U AS BRAINLIST
    5·1 answer
  • Why do some cells have different structure or more of one structure then other cells do
    6·1 answer
  • What allows humans to see color when formed correctly?
    6·1 answer
  • Which type of cell division causes a puppy to grow into an adult dog?
    5·2 answers
  • explain the differences between the particles of a pure substance and the particles of a mechanical mixture
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!